Effect Of EGFR Gene Inhibition By RNA Interference In Vitro On Proliferation And Apoptosis Of Human Pancreatic Cancer Cells

Purpose:A lentiviral vector of RNAi targeting human EGFR gene was constructed and identified. In vitro the lentiviral vector was transfected into human pancreatic cancer cell line Panc-1.The inhibitory effect was detected.The aim was to explore the prospects of lentivirus-mediated silencing EGFR application in gene therapy for pancreatic cancer in order to develop new strategy of gene therapy in pancreatic cancer.Method:1. The sequence was cloned into the LV vector to construct the lentiviral vector LV-shEGFR, which was subsequently confirmed by PCR and DNA sequencing analysis.2.293T cells were cotransfected with LV-shEGFR, pRsv-REV, pMDlg-pRRE、 pMD2G. The titer of lentivirus was determined after packaging and purification.3. After the lentivirus infection of Panc-1cells, Real-time PCR and Western-blot were used to detectmine the EGFR gene expression. The experiment was divided into Panc-1group (blank group), GFP-Panc-1group (control group) and SiEGFR-Panc-1groups (interference group).4. The growth of the cells in three groups was observed in the eight days by MTT. The cell cycle and cell apoptosis were detected by FCM.Results:1. The siRNA sequences targeted to EGFR gene were designed and LV-shEGFR was cloned and verified successfully as follows:CGCAAAGTGTGTAACGGAATA, locating in the95-115bp. 2. The virus titer was2×10TU/ml after a lot of packaging and purification.3. When transfected by EGFR siRNA lentiviral vector, the EGFR gene expression ofPanc-1was effectively suppressed and the suppression rate was80%. The EGFR protein expression greatly inhibited, the protein bands were significantly thinner, lighter, and the expression level decreased significantly.4. The interference group growed slowly than blank group and control group obviously(p<0.05). Inhibiting EGFR gene can step down the growth of Panc-1cells.The apoptosis rate in interference group was (18.4±2.29)%larger than control group(7.36±1.38)%or blank group(7.72±1.15)%obviously(P<0.05). The numbers of G2/M phase in interference group were less than that in control group or blank group. The numbers of S phase in interference group were more than that in control group and blank group obviously (P<0.05).There was no difference in cell cycle and cell apoptosis between control group and blank group(P>0.05). The numbers’of G2/M phase were reduced and S phase were increased by inhibiting EGFR in Panc-1.Conclusions:1. The lentiviral vector is a useful tool for delivery of siRNA (shRNA) into pancreatic cancer cells.2. High titer vectors were obtained for LV-shEGFR(2×108TU/ml).3. The EGFR gene silencing effect was observed when LV-shEGFR was applied and the expression of EGFR mRNA and protein were markedly inhibited.4. The lentiviral vector carrying SiEGFR could inhibit proliferation and promote the apoptosis rate of pancreatic cancer cells.