| Chaetomium globosum ND35strain is a kind of endophytic fungus isolated from Populus tomentosa. This fungus shows its antagonism against many plant pathogens, and the secondary metabolites produced by ND35promote the growth of plants and induce resistance to plant diseases. In order to understand the mode of colonization on plant by C. globosum, the real-time quantitative PCR technology has been used and three research sections have been investigated such as detection conditions for establishment and optimization for C. globosum, colonization on different plant and different tissues and its colonization in soil, etc. The results have been obtained as followings:A set of primers for real-time PCR was designed by using specific segments of C. globosum. The sequence of primers follows as:ND35-1:GCTCGCAGCTCTGGTGCGGTG, ND35-2:GCCGATTGCCCATGTCCACCTC. Besides, the optional real-time fluorescence quantitative PCR system, the sensitivity and amplification program have been investigated by using the new specific primers. Chaetomium globosum strain ND35genomic DNA served as template and the gene of coding the glyceraldehyde-3-phosphate dehydrogenase (GAPHD) served as a reference gene. Positive results have been got in this study. The mode of colonization of C. globosum in poplar, cucumbers, peppers, tobacco was detected by using the optimized real-time quantitative PCR system. Result indicated that stain ND35can establish in all the plant tissues, but there is a significant difference in the establishment of the stain in different plants and different tissues, especially in the different tissues of the poplar from different growing seasons.The growth and colonization of the Chaetomium globosum strain ND35in the soil was detected by real-time quantitative PCR system and the result shows that the Chaetomium globosum strain ND35can grow and breed in the soil. |