Font Size: a A A

Down-regulation Of Telomerase Activity And Apoptosis Of Nasopharyngeal Carcinoma Cells Induced By PinX1 Gene

Posted on:2012-10-22Degree:MasterType:Thesis
Country:ChinaCandidate:X F LaiFull Text:PDF
GTID:2214330368475568Subject:Head and Neck Surgery
Abstract/Summary:
Background:Nasopharyngeal carcinoma (NPC) is one of the most incident and dangerous malignant tumors in southern provinces of China. Genetic factors and environmental factors including Epstein-Barr virus are the two major risk factors for NPC. Radiotherapy along with other auxiliary methods such as chemotherapy is used to treat NPC. Although equipments and technologies in radiotherapy and chemotherapy have been greatly advanced in recent years, the 5-year survival rate of patients with NPC remains about 50%. In addition, systemic and local side effects caused by chemotherapy greatly humbled the patient physically and psychologically. Therefore, it is of importance to study the etiology of NPC and explore new, safe and effective modalities for NPC therapy.Including Nasopharyngeal carcinoma,most of dangerous malignant tumors have a close relationship with an increase in telomerase activity and mRNA level of telomerase catalytic subunit (hTERT). Targeted on telomerase has been one promising treatment of tumor-targeted gene therapy. And this will be a new and research hotspot. Pin2/TRF1 interacting protein X1 (PinX1) was recently found as a tumor suppressor and telomerase inhibitor in vivo. It is expressed in normal human tissues, but not or less expressed in tumor tissues. The role of PinXl gene in tumor regulation through telomerase/telomele is very complex. Studies have found that PinXl can inhibit telomerase activity in gastric and liver tumor cells and induce their apoptosis. The expression of PinXl has been positively correlated with telomerase activity in leukemia. However, some studies on prostate cancer, gastrointestinal cancer and medulloblastoma indicate that gene polymorphism rather than PinXl expression is the key factor in inhibiting telomerase and PinX1 as a microtubule binding protein plays an important role in stabilizing chromosome. In short, the mechanisms by which PinXl regulates telomerase/telomere in tumor cells are complex and may vary in different tumors.Now, the effect of PinX1 on NPC apoptosis and the mechanisms by which PinXl affects telomerase activity have not been reported. Therefore, in this study, we constructed PinXl expression vector and utilized its small interfering RNA to study its possible role in NPC.Objective:To construct PinXl expression vectors (pEGFP-C3-PinXl) and utilize its small interfering RNA (PinX1-FAM-siRNA), and to investigate effects of them on proliferation, adhesion, migration, invasion telomerase activity and apoptosis of high metastatic potential 5-8F cell line. By this way, it can offer objective proof to identify new target in molecule-targeting treatment of nasopharyngeal carcinoma. Methods:1. Cell linesHuman nasopharyngeal carcinoma 5-8F cells(NPC 5-8F) and human vascular endothelial cells ECV-304were kindly provided by Department of Cell Biology, the Southern Medical University.2. Cell cultureNPC 5-8F and ECV-304 were maintained in RPMI 1640 and DMEM, respectively, supplemented with 10% calf serum,100 U/ml penicillin and 100 U/ml streptomycin at 37℃in a 5% CO2 incubator as previously reported. After passaged using conventional method, cells were used for experiment at logarithmic phase.3. Plasmid constructionSynthesized PinX1 DNA was inserted into pEGFP-C3 vector at XhoⅠand EcoRⅠsites. Recombinant plasmid was transformed into E. coli DH5αand screened by kanamycin and neomycin resistance. Positive pEGFP-C3-PinX1 was further identified by DNA sequencing.4. PinX1 siRNAPinX1 siRNAs were designed using online software from Invitrogen company (http://maidesigner.Invitrogen.com/maiexpress/). After blast and analysis for homology in human genome, three siRNAs PinX1-963, PinX1-695 and PinX1-242 were selected and used to silence PinX1. Preliminary experiments indicated that PinX1-695 with sense sequence of 5'-GUAAAGAUGUGGAAAGUUATT-3'and anti-sense sequence of 5'-TTCAUUUCUACACCUUUCAAU-3'could effectively downregulate PinX1. Therefore, it was synthesized as FAM-labeled siRNA and used in all experiments.5. Experimental design and cell transfectionCells at logarithmic phase were inoculated into 24-well plated cultured in media without antibiotics for 24 h to reach 80-90% confluency. Cells were then transfected with pEGFP-C3-PinX1, pEGFP-C3, and PinX1-FAM-siRNA using Lipofectamine 2000TM according to the protocol provided by the manufacturer.24-48h after transfection, cells were observed under fluorescence microscope to examine transfection efficiency.6. RNA isolation and measurement of PinX1 mRNA levels by RT-PCR48h after transfection, total RNA was extracted with Trizol following the manufacturer's instruction. FourμL mRNA of each sample was reverse transcribed into cDNA by AMV reverse transcriptase and used as template in RT-PCR. PCR condition used for PinX1 and internal reference GAPDH was 94℃for 2 min followed by 25 cycles of 94℃for 1 min,55℃for 1 min and 72℃for 2 min, and 72℃for 5 min. The specific primers used in these reactions were followings:PinX1 forward 5' TTTTCTCGAGATGTCTATGCTGGCTGAACG 3' and reverse 5' TTTTGAATTCTCATTTGGAATCTTTCTTC 3'and GAPDH forward 5' GGAAGATGGTGATGGGATT 3'and reverse 5'GGATTTGGTCGTATTGGG 3'. The expected PCR products were 987 bp and 205 bp for PinX1 and GAPDH, respectively. The amplicons were analyzed by electrophoresis, imaged using UVI gel imaging system and qantified using Quantity one software. Expression levels of PinX1 were normalized to internal reference GAPDH.7. Measurement of cell proliferation by MTT NPC 5-8F cells at logarithmic phase were inoculated into 96-well plate with 5×103 cells in each well. Cell viability at 0 h,24 h,48 h and 72 h was examined using MTT method. OD490nm values at each time point were detected in six duplicate wells and their averages were used to plot growth curve and calculate the growth inhibition rate of each treatment using the following formula:Growth inhibition rate (IR)=(OD49o of the control group-OD490 of the treatment group)/OD490 of the control group×100%.8. RNA isolation and measurement of hTERT mRNA levels by RT-PCR48h after transfection, total RNA was extracted with Trizol following the manufacturer's instruction. FourμL mRNA of each sample was reverse transcribed into cDNA by AMV reverse transcriptase and used as template in RT-PCR. PCR condition used for hTERT and its internal reference GAPDH was 94℃for 4 min followed by 30 cycles of 94℃for 30 sec,49℃for 30 sec and 72℃for 45 sec and 72℃for 5 min. The specific primers used in these reactions were followings:hTERT forward 5' CCGAGTGACCGTGGTTTCTGTG 3' and reverse 5'GGAAGCGGCGTTCGTTGTG 3' and GAPDH forward 5' GGAAGATGGTGATGGGATT 3' and reverse 5' GGATTTGGTCGTATTGGG 3'. The expected PCR products were 670 bp and 205 bp for hTERT and GAPDH, respectively. The amplicons were analyzed by electrophoresis, imaged using UVI gel imaging system and qantified using Quantity one software. Expression levels of hTERT were normalized to internal reference GAPDH.9. Detection of telomerase activity by stretch PCR NPC 5-8F cells at logarithmic phase were inoculated into 6-well plate with 1×106/well.24 h later, cells were transfected as described above.48 h after transfection, telomerase activity was measured using stretch PCR assay based on the protocol provided by the manufacturer. Meanwhile, telomerase activity in control ECV-304 cells was similarly examined.10. Effect of PinXl on cell migrationCell migration was examined using transwell. In detail, NPC 5-8F cells at logarithmic phase were starved overnight in serum free RPMI1640 media. Cells were detached and washed with PBS, they were resuspended in RPMI 1640 and adjusted to 1×105/mL.200μL cell suspension was added into the upper chamber of the transwell and 500μL RPMI 1640 containing 10% newborn calf serum (as a chemokine) was added into the lower chamber of the transwell. The transwell was then cultured at 37℃in a incubator supplemented with 5% CO2.24 h later, cells on the upper surface of polycarbonate membrane of the transwell were removed with a cotton swab and the cells that migrated onto the lower surface of the membrane were fixed with 4% paraformaldehyde for 15 min, washed three times with PBS for 5 min each and stained with crystallization violet for 3 min. After further wash with PBS, the memberane was air dried and cell number on the membrane was counted under microscope at 400 magnification. The number of migrated cells was expressed as the average of five randomly selected fields.11. Scratch assay Transfected NPC 5-8F cells at logarithmic phase were inoculated in 6-well plate pre-coated with collagen IV. When monolayer was formed, cells were scratched with a 100μL tip and cultured in media containing 10% FBS. Zero,12,24, and 36 h after scratching, cells in each well were photographed under microscope. The distances between the two edges of the scratched cells in four fields were measured and the average distance was used to calculate the healing rate using the following formula: Healing rate= (the distance before healing-the distance after healing)/the distance before healing)×100%.12. Measurement of cell cycle and apoptosis by flow cytometry48h after transfection, NPC 5-8F cells were collected, washed with PBS, resuspended in PBS at 1×106/mL, and stained with Annexin V and propidium iodide solution (PI) for 15 min at dark. Apoptotic cells were then analyzed by flow cytometry and apoptotic index (AI) was calculated using formula AI= (apoptotic cells/total cells) X 100%. Cell cycle was determined after fixing with pre-cooled 75% ethanol at 4℃and wash with PBS.13. Statistical analysisData were expressed as mean±standard variation (X±S) and analyzed using SPSS 13.0 statistical software package. Differences between samples in RT-PCR, telomerase activity, migration assay, scratch assay, cell cycle and apoptosis assay were tested using single factor analysis of variance and LSD/Dunnett's T3 method for multiple comparisons. Differences between samples in proliferation assay or scratch assay were tested using factorial design analysis of variance and SNK method for multiple comparisons. A p value less than 0.05 was considered as significant difference. Before comparison, data homogeneity of variance was first examined using F test. In the case of heterogeneity of variance, the approximate variance F test /Welch method was used.Results:1. Construction and identification of recombinant plasmidWe first confirmed the successful construction of PinXl expression vector pEGFP-C3-PinX1 by bi-directional sequence analysis.2. Trans fection of recombinant plasmidWe then examined the transfection efficient under fluorescence microscope. About 80% of cells were transiently transfected.3. Examination of PinXl mRNA level in NPC 5-8F cells by RT-PCRWe next detected PinXl mRNA level in NPC 5-8F cells by RT-PCR. The result was an expected fragment of 987 bp which was amplified in samples isolated from non-transfected NPC 5-8F cells, Lipofectamine treated cells, and cells transfected with pEGFP-C3-PinX1 and pEGFP-C3, respectively, but not in NPC 5-8F cells transfected with PinXl-FAM-siRNA. Its intensity was the strongest in cells transfected with pEGFP-C3-PinXl. PinXl mRNA level in cells transfected with pEGFP-C3-PinXl is 1.6-fold of that in untreated cells (p<0.05). By contrast, PinXl mRNA level in cells transfected with PinX1 -FAM-siRNA reduced by70% compared with that in untreated cells (p<0.05). In addition, PinXl mRNA level in cells treated with lipofectimine alone or transfected with pEGFP-C3 was not significantly changed (p>0.05), which meant factors such as pEGFP-C3 and lipofectimine had no influence on PinX1 mRNA level in NPC 5-8F cells4. Cell survival rate by MTT methodFactorial design analysis of variance found that there was difference between groups (F=35.870,P=0.000).the mean value of OD490 in cells transfected with pEGFP-C3-PinX1 was 2.15, which was significantly decreased compared with that of 2.52 and 2.50 in untreated NPC 5-8F cells and cells transfected with PinX1-FAM-siRNA, respectively. In addition, there was no significant difference in the mean value of OD490 in untreated cells, lipofectimine treated cells, cells transfected with pEGFP-C3 and cells transfected with PinX1-FAM-siRNA. The cell growth curve by plotting the OD490 value vs time (0h,24h,48h and 72h). Cell growth rate calculated based on the curve indicated that overexpression of PinX1 significantly inhibited the growth of NPC 5-8F cells, whereas downregulation of PinX1 by siRNA transfection did not affect the growth of NPC 5-8F cells.5. Migrating measurement by Transwell areolesWe further explored the effect of PinX1 on NPC 5-8F cell migration. Overexpression of PinX1 by transfecting pEGFP-C3-PinX1 significantly decreased NPC 5-8F migration compared with untreated cells (F=17.162, P=0.000). By contrast, attenuated Pin X1 expression by transfection of PinX1-FAM-siRNA did not affect NPC 5-8F cell migration (p>0.05). In addition, transfection of pEGFP-C3 and treatment with lipofectimine alone did not alter the ability of NPC 5-8F migration (p>0.05).6. Influence of PinXl gene on wound healing ability Factorial design analysis of variance showed that overexpression of PinX1 by transfection of pEGFP-C3-PinXl significantly attenuated the mean healing rate of untreated 5-8F cells from 50% to 31%, and the healing rates at 12 h,24 h and 36 h (p<0.001). By contrast, the healing rate of NPC 5-8F cells was not affected by treatment of lipofectamine alone and transfection of pEGFP-C3 and PinX1-FAM-siRNA(p>0.05).7. Influence of PinXl gene on hTERT mRNA level and telomerase activityOverexpression of Pin X1 by transfection of pEGFP-C3-PinX1 significantly reduced hTERT mRNA level by 29.9% and decreased telomerase activity in NPC 5-8F cells (p=0.000). By contrast, reduced PinX1 by transfection of PinX1-FAM-siRNA had effects on neither hTERT mRNA level nor telomerase activity in NPC 5-8F cells (p>0.05). In addition, hTERT mRNA level and telomerase activity in NPC 5-8F cells were not affected by transfection of pEGFP-C3 and treatment of lipofectamine alone.8. Influence of PinX1 gene on cell cycle and apoptosis by flow cytometryOverexpression of PinX1 by transfection of pEGFP-C3-PinX1 significantly increased the percentage of NPC 5-8F cells at G0/G1 phase from 42.7% to 64.7% (p<0.001). However, downregulation of PinX1 by transfection of PinX1-FAM-siRNA, liopafectamine treatment, and transfection of pEGFP-C3 did not affect the percentage of NC 5-8F cells at G0/G1 phase.We last examined the effect of PinX1 on NPC 5-8F by Annexin V/PI staining. Living cells were Annexin V(-)/PI(-) at the lower left quadrant in flow cytometry diagram. Cells with Annexin V(+)/PI(-) at the lower right quadrant were at the early apoptotic status; cells with Annexin V(-)/PI(+) at the upper right quadrant were at late apoptotic status. And overexpression of PinXl by transfection of pEGFP-C3-PinX1 significantly enhanced AI to 49.73±2.70%(p<0.01). In addition, there was no difference of AI among untreated cells, cells transfected with pEGFP-C3, cells treated with lipofectamine and cells transfected with PinX1-FAM-siRNA (p>0.05).Conclusion:In conclusion, PinXl is an endogenous telomerase inhibitor in NPC 5-8F cells and plays important roles in tumor cell proliferation, migration and apoptosis. Low expression of endogenous PinXl could be the major reason for no effects of its silencing on the in vitro characteristics of NPC 5-8F cells. Taking together, PinX1 as an endogenous telomerase inhibitor has application potential in tumor-targeted gene therapy.
Keywords/Search Tags:PinX1 gene, RNAi, Telomerase inhibitor, Nasopharygeal carcinoma, Apoptosis, Gene therapy
Related items