| IntroductionRecent reports have demonstrated that p-catenin ( (3-cat) is a multifunctional protein involved in two apparently independent processes , acting as a cell - cell adhesion regulator when coupled with cad-herin and a key controler in the Wnt signal transduction pathway which may develop many cancers. The mutuant gene of β-catenin have been often detected in some neoplasias in previous studies.Endometrial carcinoma is one of the most threatened diseases to women, we performed the immunohistochemical method and single -strand conformation polymorphism - polymerase chain reaction (SSCP -PCR) analysis to investigate the expression and genie mutation of β-cat in endometrial carcinoma, and in the meanwhile ,to study the relationship of β-cat to the clinicopathological features so as to diss-cuse further what's role β-cat may play in the development of endometrial carcinomas.Material and method1. CaseA total of 31 endometrial carcinoma and 10 nomal endometria were collected at gynecologic department and clinic in the Second Affiliated Clinical Hospital of Chinese Medical University from Jan 2001 to Sep 2002. All the fresh samples were put into -70# icebox immediately after surgery. According to FIGO( 1988) standard , 31 endometrial carcinomas consisted of 25 stageIA2 stage II, 4 stage III, 0 stageIV and 18 gradeI, 10 grade IK 3 grade H. There were 25 endometri-oid adenocaxcinomas and 6 non - endometrioidadenocarcinomas. 8 samples had no myometrial infiltration, 12 were infiltrated by less or eaqual harf - myometrium and 5 more than half. The patients were 35 - 69 years old ( average age is 56). There were complete clini-cophathological materials provided and the histological diagnosis were confirmed by two emperical pathologists.2. MethodImmunohistochemistry of the paraffin bembedded sections was performed by SABC method . SSCP - PCR analysis: DNA was extracted by standard techniques from fleash tissue specimens. Then a ge-nomic fragment including exon 3 was amplified using primers G - F, 5' - CCAATCTACTAATGCTAATAACTG -3'andG-R,5'- CTG-CATTCTGACTTTCAGTAAGG -3'. Each reaction was carried out for 2 min at 94℃ for initial denaturing followed by 35 cycles of 94℃ for 30s, 55℃ for 30s, and 12℃ for 30s. The PCR product was then electrophoresed in 10% polyacrylamide gels containing 5% glycerol after denaturalization in ice. At last, gels was stained and visualized with silver nitric - acid.3. Analysis of resultsThe results of immunostaining were classified as (1) membranous expression, which is normal, when the brown - dye located only at cell membrane; (2) cytoplasm expression when the staining was in the cytoplasm, ( 3 ) nuclear expression when the brown stained the nu-cleolus. (2) and (3) was regarded as abnormal expression (accumulation pattern) .SSCP - PCR analysis: the normal bands revealed at two fragments of 129bp and 181bp, whereas the mutant remained at 310bp as well as129bp and 181 bp fragments.4. Statistical analysisAll data were analyzed by statistic software SPSS. Chi - square test and Fishers exact probability were used.Result1. Accumulation of β-catenin was detected in 74% of endometri-al carcinoma and 30% of normal endometria. The statistical difference is distinctive (P < 0. 05). The cytoplasm or nuclear expression was observed more often in stage 1 (84% ) than in stage 2 and 3 (16% ) , (P<0. 05). The accumulation was observed more frequently in the endometrioid adenocarcinomas than in non - endometrioid adenocarcinomas (P < 0. 01) , and tend to occur in well - differenciated histolog-ical types (P<0.05). By contrast, the accumulation pattern had no correlation with the level of myometrial infiltration, all P >0. 05.2. The mutant bands of SSCP - PCR were detected in 5 samples, which were all endometrial carcinoma and all of them were stagel, despite the data had no statistical significance ( P >0. 05) . Besides, all the mutant were accompanied by accumulation and the difference is significant (P<0. 05).Conclusion... |
PDF Full Text Request