ObjectiveThe purpose of this study was to know the nosogenesis to the patients with MFS, and to provide detecting bases for their family members'presymptomatic diagnosis and their offsprings'prenatal gene diagnosis, through detecting the mutations of fibrillin-1 gene(FBN1), transforming growth factor beta receptor typeâ…¡(TGFBR2) gene and transforming growth factor beta receptor Typeâ… (TGFBR1) gene.MethodsPolymerase chain reaction (PCR) and denaturing high-performance liquid chromato-graphy (DHPLC) were used in screening for the mutations in FBN1, TGFBR2 and TGFBR1. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. After the mutation detected, DHPLC screening and sequence analysis were performed on the corresponding DNA amplification fragments of the proband's family members and the 120 randomly selected normal controls. Besides, the pathogenicity of the novel mutation was analyzed with the following two methods:blasting the sequence of mutation spots with the wild protein domain and analyzing the differences of simulant three-dimensional protein domain between wild protein and mutation protein.Results1. Four different pathologic mutations (2 of them were novel mutations) were detected in FBN1, in the 9 probands with MFS.(1) The multiplex mutation was a novel mutation, which located in exon 55 containing a deletion mutation c.68626871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861 A>G) and an intronic mutation c. [IVS55+1IVS55+11delGTAAGAGGATC; IVS55+34dupCATCAGAAGTGACAGTGGACA]. (2) The missense mutation (p.Cys821Tyr), located in exon 20 at nucleotide 2462 (c.2462G>A), was a novel mutation.(3) The splice site mutation which located in intron 46 at nucleotide+5 (c.IVS46+5G>A), was a reported mutation.(4) The nonsense mutation (p.Argl125X), located in exon27 at nucleotide 3373(c.3373C>T), was a reported mutation.2. The 4 mutations mentioned above were also found in the corresponding probands'family patients, but not found in the proband's family healthy persons and normal controls.3. Blasting the sequence of mutation spots with the wild protein domain showed that the two movel mutations (p.Gly2288MetfsX109 and p.Cys821Tyr) both located important protein domain in FBN1-calcium binding epidermal growth factor(cbEGF); and both changed the conserved cysteine in the cbEGF.4. Analyzing the simulant three-dimensional protein domain indicated that the two novel mutations (p.Gly2288MetfsX109 and p.Cys821Tyr) both changed the wild three-dimensional protein domain.Besides,6 different single nucleotide polymorphisms (SNPs) were also detected in FBN1. They were c.3442C>G (p.Prol148Ala), c.IVS34-10C>T, c.IVS 41-22 insT, c.IVS45+29insT, c.IVS56+17C>G and c.IVS62+8A>C.Among them, c.IVS34-10C>T and c.IVS 41-22 insT were novel SNPs. Nevertheless, mutations were not found either in TGFBR2 or in TGFBR1.Conclusion1. The results indicated that the deletion mutation c.[68626871del GGCTGTGTAG; 6871+16871+11delGTAAGAGGATC] (p.Gly2288MetfsX109), the missense mutation (p.Cys821Tyr), the splice site mutation (c.IVS46+5G>A) and the nonsense mutation (p.Argl 125X) of FBN1may cause the responding patients with MFS respectively.2. Mutation analyses of the FBN1, TGFBR2 and TGFBR1 are helpful to know the nosogenesis to the patients with MFS, and can provide detecting bases for their family members'presymptomatic diagnosis and their offsprings'prenatal gene diagnosis. 3. DHPLC is a high efficiency, simple, low-cost and reliable method for mutation detection and suitable for a large amount mutations detection.4. There may be some other candidate genes related to MFS, except FBN1, TGFBR2 and TGFBR1.
|