Anti-tumor Activity By Targeting The Keratin-19 Positive Cells In Carcinoma Cell Lines

1 BackgroundKeratins are the biggest family of the cytoplasmic intermediate filaments (IFs), comprising cytokeratin and"hair/nail-type"keratins. The family distinguish themselves by their epithelial-specific expression. Moreover, cytokeratins show strict lineage and differentiation-associated expression. Their function in epithelial is to provide the cell with mechanical support and to maintain cellular integrity. The abnormal expression of keratins is considered to be related to various diseases including cancer.Keratin 19, a type 1 intermediate filament, is the smallest in size and unlike any other keratins, it didn't have a consistent coexpressed keratin partner. It's widely considered as a skin stem cell maker, in tissues other than skin, it's usually distributed in less differentiated cells. The unique expression pattern has evoked speculation of the possibility that the keratin 19 positive cells may be the targets of transformation and studies focused on differences of keratin expression between normal cells and tumor cells demonstrated that various kinds of tumor cells including mammary cancers, thyroid carcinomas, cervical carcinomas and lung carcinomas showed elevated expression of K19.K19 expression was also showed to associate with neoplastic progression of cells of different origin and the up-regulation of its expression might signify aggressive tumor behavior and influence the drug resistance of cancer cells. It kept researchers wondering that whether the expression pattern of keratin 19 in neoplasm tissues could provide sufficient sensitivity and specificity to treat these cancers by targeting the K19 positive cells.Here the very feasibility of inducing cancer cells death utilizing the Herpes Simplex virus thymidine kinase gene (HSV-tk) suicide gene therapy harnessing the K19 promoter is evaluated.2 PurposesTo construct a vector employing the promoter region of mice keratin 19 (K19) to control the specifically expression of Herpes Simplex virus thymidine kinase gene (HSV-TK) and evaluate its capability to induce cancer cells death.3 Materials and methodsThe plasmid pK15-Tk was a kind gift of George Cotsarelis , M.d. of University of Pennsylvania. PAM212, the malignantly transformed mouse keratinocytes cell line, brought to us by Li Jin from second military medical university who never hesitate to extend help to us and also by the entrustment of the owner,Dr S. Yuspa, Bethesda, MD.3.1 Cloning of keratin 19 promoter and constructing the plasmid pK19-TKThe k19 promoter was cloned from genomic DNA of Balb/c mouse by PCR. Genomic DNA isolated from the skin tissue of newborn mice 4 days postpartum using a genomic DNA purification kit (Shengneng biocolors) was performed by the instruction of the manufacture. We chose the skin of newborn mice for the source of genomic DNA. Concisely, the newborn mice was sacrificed by CO2 narcosis, rinsed twice in 70% ethanol, skin was peeled off the carcass using forceps using an aseptic forceps. Following steps were simply done by the protocol provided by the manufacture.We used two sets of primers for the amplification of keratin 19 promoter (-2.1kb) and its partial sequence (-0.5kb) respectively. The primer sequences of the whole length promoter were CGGCTCGAGAAGTTCCTTTCTAAGACCCA (K19F1) and AGGACTAGTGGAAAAAGGGACGCAGGTCT (K19R). The sequences of the other set of primers were AGGCTCGAGTTATCACAAGGAGGGAGGGA (K19F2) and AGGACTAGTGGAAAAAGGGACGCAGGTCT (K19R) respectively. Note the restriction sites for Xho 1 and Spe I were added to the 5'-end of the primer for the following directional cloning. For the amplification of the partial K19 promoter sequence from 0.2 ug genomic DNA, the PCR was performed using Pfu Taq polymerase from Shengneng biocolors., after an initial denaturation step of 4 minutes at 95°C, 30 cycles of amplification were carried out as follows: denaturation, 60 s at 95°C; annealing, 60s at 57°C; extension, 60 s at 72°C, and a final extension for 8 minutes at 72°C. The K19 (-2.1kb) was amplified using PrimeSTAR? HS DNA Polymerase from Takara bio., after the initial denaturation at 95°C for four minutes, following denaturation took 10s at 98°C, annealing took 15s at 54°C, the extension step took 2 minutes at 72°C, reaction was carried out under this circumstance for 26 cycles, followed by a final extension step for 10 minutes at 72°C. Both of the desired fragments were isolated and purified by agarose-gel electrophoresis and gel extraction using a kit from E.Z.N.A. The fragments and the plasmid pK15-tk were digested with Xho 1 and Spe I restriction enzymes (Takara bio.), purified and ligated using the ligation kit from Toyobo. DH5a competent cells were used as a transformation host and to produce the plasmid needed in the following experiments. Both of the newly constructed plasmids were subjected to agarose gel electrophoresis and DNA sequencing for validation.3.2 Cell culture and transient transfections studiesPam212 cell lines and A549, a human lung carcinoma cell line, as well as Siha and Hela, both were human cervical carcinoma cell lines, were maintained in Dulbecco's modified Eagle's medium (Hyclone) supplemented with 10% fetus bovine serum (Gibco). Medium was changed twice a week; when the cells reached confluence, they were subcultured and plated for transfection. Transfections using Lipofectamine 2000 transfection reagent were carried out by the protocol provided by the manufacture. Concisely, after seeding cells in 6-well plate, once the cells growing in log phase reached near 90% confluence which usually took overnight incubation, 4μg of plasmid DNA and 6μl of Lipofectamine 2000 were diluted by 250ul of Opti-MEM respectively, the complexes produced by combining the diluted DNA and diluted Lipofectamine 2000 were added to wells containing cells and medium. After 48 hours incubation at 37°C in a CO2 incubator, medium was changed and the prodrug ganciclovir was added to the medium at a concentration of 100μM。3.3 MTT assayFirst, 0.2μg of plasmid DNA and 0.5μl of Lipofectamine 2000 were diluted respectively in 25μl of Opti-MEM, complexes were added to the wells, after incubation, cells in a 100ul volume were plated direction into the transfection mix. After incubation for 48 hours, ganciclovir was added at different concentration ranging from 2μM to 100μM. 72 hours later, the cell viability was determined by MTT assay. The test is based on the fact that live cells could cleave the yellow tetrazolium salt MTT to purple formazan crystal and the latter could be quantified by its optical density at 570 nm. The result is proportional to the viable cell number.3.4 Flow cytometric analysisTransfected cells are incubated in medium that supplemented with ganciclovir at a concentration of 100μM for 72 hours. At that time, cells were washed with PBS, trypsined with trypsin-ethylenediaminetetraacetic acid, harvested by centrifugation, washed again, after overnight incubation in 70% ethanol at -20°C, ethanol was removed by centrifugation and cell pellets were stained by 1ml of DNA staining buffer which was mainly composed by propidium iodide and Ribonuclease A). Cell cycle analysis was accomplished by a flow cytometer.4 Results2.1 GCV could induce death of transfected cells in a dose-dependent manner. Through MTT assay, take the PAM212 as an example, transfected cells when exposed to GCV at a 2μM concentration, after 72 hours, 19.4% of the cells were killed, when exposed to GCV at higher concentrations, 10mM and 100mM, 44.4% and 58.7% of the cells were killed respectively. It was the same case for A549, the human lung carcinoma cell line; but not for the human cervical carcinoma cell lines, namely, Hela and Siha. The latter two cell lines showed no significant sensitivity to GCV after transfection, that was what we hadn't expected.2.2 Cell cycle analysisTreatment of the transfected Pam212 and A549 cell lines with GCV led to marked alteration in cell-cycle distribution, percentage of cells in S phase were much higher than their untransfected counterparts, also the apoptotic rates of the transfected cells represented by the percentage of cells in sub G1 phase were significant higher.5 DiscussionCytokeratin 19 is expressed by many epithelial cells. More than often, its expression is elevated during malignant transformation of these cells. Based on the fact that expression is elevated in the malignant tissues than their normal counterparts and K19 positive cancer cells are often found in blood of the patients with metastatic tumors, the expression level of keratin 19 has long been used as a diagnostic and prognostic indicator. There are also studies suggested that keratin 19 expression was associated with higher migrating activity of human retinal epithelial cells. Koizumi M et. al correlated keratin 19 expression with high motility of cancer cell lines through the examination of the relationship between the morphology and the motility of human endometrial undifferentiated cancer cell lines. Studies by C C. Yuan et al. quantified the K19 levels in tissue extracts of cervical cancer patients; found that its expression was skyrocketing in the neoplasm tissue compared with other tissues. Moreover, they suggested that elevation of K19 expression could associate with the apoptotic resistance and malignant progression of cervical carcinoma. So here we ventured into a bolder speculation that the K19-positive cells in these carcinomas might represent a group of cells that were more aggressive and less reactive to treatment. Though its use in cancer gene therapy is rarely reported, we were interested in finding out if the treatment based on targeting this group of cells had a future.In our study, the two human cervical carcinoma cell lines failed to show significant sensitivity to the prodrug ganciclovir after transfection, we suppose the reasons might be as follows; the transfection efficiency might be too low for expression of the thymidine kinase to be detected by our method; we are now working on this; and also the mechanism of transcription control in different tissue might differs.Our study shows that cancer cells death induction employing their K19 expression pattern is of potential value. As we've said that our study still at its very early stage, there's a lot of work to be done, a lot of hurdles to get over.