Effects Of Shenkang Pill On The Expression Of Nephrin And Desmin In The Podocyte Of Diabetic Nephropathy Rats

BackgroundDiabetic nephropathy(DN) is the result of the systemic microvasal pathologicalchanges, and one of the common chronic syndromes of diabetesmellitus(DM). Nowadays, DM has been becoming a tertiary chronic disease ofendangering people, just inferior to the tumors and cardiopathy as well asencephalopathy. There are about 135 million diabetic all over the world, and 30-40million in China, at the same time, domestic morbidity had been rising in recentyears. The occurrence of clinical albuminuria in DN indicates the bad prognosis, namely the DN usually rounds into end stage renal disease, which burdens theindividual and the society heavily. Therefore it is important to take measures to arrestthe clinical phase of DN or decrease the incidence rate of clinical phase of DN in theearly stage of microalbuminuria phase.The experiment divided two parts to research shenkang pill(肾康丸) treat withDN. The first part investigated the possible mechanism of shenkang pill in therenalprotection through establishing the DN model, in order to detect themicroalbuminuria, urinary protein quality in 24 hours, body weight(Bwt), kidneyweight(kwt), relative kidney weight(kidney weigh/ body weight), glucemia, ureanitrogen, creatinine, total cholesterol, triacylglycerol, pathological changes of kidneyand the antigen expression of desmin in podocytes. The second part investigated the effect of shenkang pill on the expression of nephrin by immunohistochemistry andreverse transcription polymerase chain reaction (RT-PCR).ChapterⅠEffects of Shenkang Pill on the expression of desmin in the podocyteof diabetic nephropathy rats.Object: To research the antigen expression of desmin in DN rats and the possiblemechanism of shenkang pill in the renalprotection on DN rats.Methods:1,DN model and medical dosage.The DN model were established by a single injection of streptozotocin(STZ), and then were randomly divided into 4 groups: shengkang pill group,irbesartangroup,combination group(shengkang pill and irbesartan),model group, as well asnormal group in addition. All rats were received daily gavage respectively for 8weeks, the shengkang pill group with the lixivium of shengkang pill(350mg/ml, 1ml/220g wt), the irbesartan group with the solution of irbesartan tablets(3 mg/ml, 1ml/220g wt), the combination group with the mixture of shengkang pill andirbesartan tablet(353 mg/ml, 1ml/220g wt). The normal and model group werereceived daily gavage with the saline water(1ml/220g wt). Then, compared therenalprotection through examinating the parameters of body weight, kidney weight, relative kidney weight, urinary protein quality in 24 hours, glucemia, urea nitrogen, creatinine, total cholesterol, triacylglycerol. Moreover, the pathological changes ofkidney were observed with optic microscope and transmission electron microscope.2,The immunohistochemistry of desmin.Paraffin sections were incubated 2 times in xylene for 10 minutes each, and twicein 100% ethanol for 2 minutes each, and then hydrated the slides by placing in 95 %, 80%, 70 % ethanol and water for 2 minutes each, then inactivated the peroxidase byincubation for 30 minutes in 3% hydrogen peroxide in PBS. Afterwards, washed theslides in PBS buffer for 20 minutes. Removed the excess buffer and then incubatedthe slides with primary antibody(50μl rabbit anti- desmin(1: 100)) for 60 minutes atindoor temperature, then rinsed the slides with a gentle stream of PBS buffer thrice, and then incubated with secondary antibody labeled with EnVision for 30 minutesat indoor temperature, and then rinsed the slides with a gentle stream of PBS bufferthrice, finally, incubated in fresh DAB solution, stopped the reaction by washing inrunning water when a uniform brown color first became visible on the section, andrinsed the slides with a gentle stream of PBS buffer thrice once again. Incubated theslides in hematoxylic solution for 5 minutes, and then washed in running water, dehydrated in 70%, 80%, 95%, 100% ethanol for 2 minutes each, incubated inxylene for 10 minutes, and envelopped section with neutral balata. Got six sectionsfrom each group and 30 glomerular fields of vision from each sections zoomed in 400times by microscope, scored the stain according to the stain area and the shade ofcolour. Negative stain scored zero, buff stain or less than a quarter stain of the field ofvision scored 1, yellow stain or a quarter to a half stain of the field of vision scored 2, brown or nigger-brown stain or more than a half stain of the field of vision scored 3.Results:1,After injecting the STZ for 4 weeks, the microalbuminuria of rats was positiveby enzyme linked immunosorbent assay(ELISA).2,The test of urinary protein quality in 24 hours: The levels of urinary proteinquality in 24 hours had no differences among the models(P＞0.05), but significantincreased comparing with the normal group(P＜0.001). After the administration theurinary protein quality in 24 hours decreased significantly in the shengkang pill, irbesartan, combination groups (respective t values -11.684, -10.494, -4.864, respective P values＜0.001), but still higher than the normal groups(P＜0.001), Theurinary protein quality in 24 hours increased significantly (t=-12.557, P＜0.001) inthe model group, it was significant differences comparating with the shengkang pill, irbesartan, combination groups after the administration(P＜0.01). There were nosignificant for urinary protein quality in 24 hours between shengkang pill andirbesartan groups after the treatment (P=0.767), but the shengkang pill group hadsignificant difference with the combination group.3,The parameters of body weight, urea nitrogen, creatinine, total cholesterol, triacylglycerol were ameliorated remarkably among shengkang pill, irbesartan, combination groups comparing with model group(P＜0.05), while higher than normalgroup(P＜0.05). Futhermore, the mean rank of kidney weight and relative kidneyweight in model group was highest among five groups. With total cholesterol andtriacylglycerol, both shengkang pill and combination groups were lower significantlythan irbesartan group(P＜0.01). Besides, the mean rank of glucemia of shengkang pilland combination groups was also lower than irbesartan group.4,The histopathologic lesions in model group was severe, characterizedinflammatory cell infiltrating, mild mesangial expansion and matrix depositionobviously, with hypertrophy of the glomerulus, contrasting to the shengkang pill, irbesartan, combination groups. The transmission electron microscope(TEM) showedpodocytes were merged partly and even broken in model group.5,The positive stain mostly localized in the podocyte of glomerular fields. Therewere significant differences among the normal, model, shengkang pill, irbesartan, combination groups due to the glomerular stain scores(X~2=34.448, P＜0.001). Themean rank of the stain scores in the shengkang pill, irbesartan, combination groupswere higher than the normal group while lower than the model group obviously.Moreover, the mean rank of the combination group was lowest among five groups. Conclusion1,Not only was the shenkang pill's renalprotection similar to the irbesartan, butit could exert multitarget renalprotection, displayed the advantages of Chinesetraditional medicine in the fields of renalprotection in DN.2,The shenkang pill can decrease the antigen expression of desmin and relievethe damage of podocytes.ChapterⅡEffects of the shenkang pill on the expression of nephrin in thepodocyte of diabetic nephropathy ratsObject: Research the antigen and gene expression of nephrin in DN rats and theeffects of the shenkang pill on DN rats.Method:1,The immunohistochemistry of nephrin.The basic steps of immunohistochemistry of nephrin were similar to desmin. Butthe slides needed to be block the slides with 10 % goat serum for 30 minutes at indoortemperature and repaired the antigen. Got six sections from each group and 30glomerular fields of vision from each sections zoomed in 1000 times by microscope, scored the stain according to the stain area and the shade of colour. Negative stainscored zero, buff stain or less than a quarter stain of the field of vision scored 1, yellow stain or a quarter to a half stain of the field of vision scored 2, brown ornigger-brown stain or more than a half stain of the field of vision scored 3.2,In the end of the experiment, leaved six rats from each group, executed the ratsand got the kidney, the kidney weight was measured, then got rid of the membrane, washed it with the cool water pretreated with 0.1% DEPC, and then scissored about0.1g kidney cortex, kept in the -80℃refrigeratory with EP tubes. In the next step, extracted the total mRNA by Trizol and the TβRⅡgene expression was messuredby semi-quantitative RT-PCR: using the One-Step RT-PCR Kit: 5μl of total RNA and0.3μl (20mmol/L) anti-sense nephrin specific primers(5'GCCGACTTGGCATTCATACTCT3'). 5 minutes later at the temperature of 70℃, added the sense nephrin specific primers(5'CTGACTGCGGTGGAAGGGAC 3') and0.1% DEPC pretreated water to 20μl. The same method with the internal controlGAPDH was carried out(sense sequence: 5'AGATCCACAACGGATACATT3'; anti-sense sequence: 5'TCCCTCAAGATTGTCAGCAA3'). Synthesized the cDNAtemplate at 42℃for 1 hour, and inactivated the reverse transcriptase andpredenaturalized the cDNA at 94℃for 5 minutes. The PCR thermal cycler conditions: 94℃30 s, 55℃1.5 minutes, 72℃, 2 minutes, 30 cycles, in the end extended theproduct at 72℃for 7 minutes. The final product was electrophoresed in the 2%agarose gel, visualized by EB, analyzed by Gel Doc1000, the content of nephrinfragment and GAPDH fragment were compared.Result:1,The positive stain mostly localized in the podocyte of glomerular fields. Therewere significant differences among the normal, model, shengkang pill, irbesartan, combination groups due to the glomerular stain scores(X~2=14.463, P=0.006). Themean rank of the stain scores in the shengkang pill, irbesartan, combination groupswere higher than the normal group while lower than the model group obviously.Moreover, the mean rank of the combination group was lowest among five groups.2,There was significant differences on the expression of nephrin among the fivegroups(F=62.348, P＜0.001), the shengkang pill, irbesartan, combination groupswere lower than the model group(P＜0.001), and no significant differences betweenshengkang pill and irbesartan groups(P=3.77). But both shengkang pill and irbesartangroups had significant differences with the combination group(P＜0.05). Conclusion:1,The shenkang pill can play a role in renalprotection in relation to decrease theexpression of nephrin in the podocyte.2,The combination of shenkang pill and irbesartan displayed more remarkablerenalprotection effects.