Font Size: a A A

Study On The Correlation Of FasL, Cranzyme B And Perforin Expressions By Quantitation-competitive RT-PCR With Acute GVHD After Allogeneic Stem Cell Transplantation

Posted on:2006-03-12Degree:MasterType:Thesis
Country:ChinaCandidate:F YangFull Text:PDF
GTID:2144360155457579Subject:Internal Medicine
Abstract/Summary:
OBJECT: Acute Graft-versus-host disease (aGVHD)is the most frequent serious complication after allogeneic hematopoietic stem cell transplantation(allo-HSCT). Donor CD8+ cytotoxic T lymphocytes contribute mostly to aGVHD. Natuer killer(NK)cell also play an important role in this process. After allogeneic hematopoietic stem cell transplantation, the immune effective cells from donor graft, including T cells and NK cells, attacked host tissues due to distinction of HLA antigen between host and donor. In this process, many inflammatory cytokines, such as TNF, γ-IFN and the like, initiated aGVHD. So far from literature, two distinct pathways have been described for T-cell cytotoxicity: Fas/Fas ligand (FasL) passway and Perforin/granzyme B passway. In order to explore the possibility of predicting and timely diagnosing aGVHD as well as monitoring the immunological status of the patients after allogeneic hematopoietic stem cell transplantation(HSCT), we designed methods for quantitative monitoring of the expressions of Fas ligand(FasL), perforin(PRF) and granzyme B(GrB) in patients undergoing HSCT by competitive quantitative RT-PCR and observed the correlation of their expressions with aGVHD.METHOD: (1) RT-PCR synthesis of cDNAs for Fas ligand(FasL), Perforin(PRF) and Granzyme B(GrB)and T-vector cloning of competitors containing Fas ligand(FasL), Perforin(PRF) and Granzyme B(GrB) specific sequencesrespectively based on GAPDH gene. The primers designed for the analysis of Fas ligand(FasL), Perforin(PRF) and Granzyme B(GrB) cDNAs: (a) FasL 5 primers were 5~-tacccatatccccagatctagtg-3~, and 3~ primers were 5~-gcca cccttcttatacttcac-3\ (b) Perforin 5'primers were 5~-cggctcacactcacaggca g-3"and 3~primers were 5~-tgctgccgtggatgcctatg-3", (c) Granzyme B 5 primers were 5 -ggggaagctccataaatgtca~3~ and 3~ primers were 5~-cacaag agggcctccagagt-3 and for the analysis of their competitors :(a) FasL 5'primers were 5"- ATGAATTCTACCCATATCCCCAGATCTACTATGAGCCCCAGCCTTCTCCAT -3" , and 3~primers were 5"-ATGAATTCGCCACCCTTCTTATACTTCACGGTCGGAGTCAAC GGATTTG-3\ (b) Perforin 5'primers were 5'- ATGAATTCGGCTCACACTCACAGGCA GGGCGCCTGGTCACCAGGGCTGC -3' and 3~primers were 5"- ATGAATTCTGCTGCCGTGG ATGCCTATGGGGCCATCCACAGTCTTCTGG -3", and (c) GranzymeB 5~primers were 5*-ATGAATTCGGGGAAGCTCCATAAATGTCAGGGCGCCTGGTCACCGGGCTGC -3'and 3* primers were 5'- ATGAATTCACAAGAGGGCCTCCAGAGTGGGGCCATCCACAGTCT CTGG -3" . (2) Peripheral blood from 17 patients at 11 time-points after transplantation were collected respectively. The mononuclear cells were harvested by Ficoll density gradient centrifuge. Their RNAs were extracted and the cDNAs were synthesized by RT-PCR. Both of the competitor with known concentration and cDNA(2ng) were added in the PCR mixture in which the amount of primers were limited for competitive quantitative PCR to measure the amount of mRNAs which reflecting the gene expression of FasL, Perforin, Granzyme B. The PCR parameter: for Granzyme B and Perforin, after an initial 4-min denaturation at 94°C, followed by 40 cycles: 94°C for lmin, 63°C for 30s, and 72°C for lmin;then 72°C for 5min; for FasL, after an initial 4-min denaturation at 94°C, followed by 40 PCR cycles: The first 10 cycles, 94 °C for lmin, 55°C for 30s. The following 30 cycles, 94°C for 30s, 60°C for 30s, and 72 °C for 45s;then 72 °C for 5min. (3)The correlation of the expressions of FasL, Perforin, Granzyme B and the clinical aGVHD after allogeneic stem cell transplantation were then analyzed.
Keywords/Search Tags:FasL, Perforin, Granzyme B, competitive quantitative RT-PCR, aGVHD, allo-HSCT
Related items