The Profective Role Of Nerve Growth Factor On The Spinal Cord After Injury

PrefaceThe damage of the central nervous system is one of the frequently - occurring diseases on clinic at present. It influences the patients life quality seriously, constitutes serious threat to people's life. Though the domestic and international scholar explores through the research for many years , and have already made certain progress in treating, there is still a lot of questions , such as Bleeding , necrosis , inflammatory factory release in early days and the scar in later period, etc. so to look for a kind of more effective and feasible healing solution is necessary.Nerve growth factor is the fist found cellar factor that regulates cell growth, and it plays a very important role at the phrase of nerve development,neuraxon growth, neurotransmitter synthesization and cell apoptosis and so on. Nerve growth factor can protects and resumes the damaged centre and peripheral nerve function. Nerve growth factor can combine with its' receptor (one of tyrosine protein kinase receptor coded by proto - oncogene tyrosine kinase, TrkA) , Causing the molecule of receptors to gather on the cell surface, and the tyrosine protein in cytoplasmic domain may be activated, three tyrosine base in the kinase domain of its' receptor and two tyrosine base at other domain be phosphated, thus, phosphated tyrosine receptor kinase (Trk A) became the bracket which absorb all kinds of connective proteins and kinases. The protein which act on the phosphated tyrosine receptor kinase ( Trk A ) is phosphoinsitol 3 ' kinase (PDK) , phospholipase C gamma(PLCγ) and connective protein Shc, at last the signals can be transferred.The researches have suggested that nuclear factorκB , NF - κB can defencethe apoptosis. Oncogene ras can induce the apoptosis which is independent of p53, the Ras mutant NIH3T3 cell which have the deficiency of P53 in the embryo fibroblast of the mice, Masyo, etc, have proved that the inhibition of NF - κB can lead to inactivation of cell. By the similar method, it be found that NF - κB can inhibit the death of cell including human fibroblastoma line HT1080 cell, Jurkat T line cell, human bladder Cancer cell and the chemical medicine treated tumor cell. There is a NF - κB relA gene reported recently. In the RelA deficient fibroblastoma and macrophage treated by tumor necrosis factor, the activity of cell lost obviously.Nerve growth factor combined with its' receptor, activated Ras - MAP kinase , mitogen - activated protein kinase kinase ( MEKKl) is the important regulating factor that make IkB kinase, IKK, phosphated, IkB kinase make the IκBα: (the subunit of NF - κB ) phosphated, the phosphated IkBα degraded, and p65 - p50 heterodimer can be formed, then the heterodimer translocated to nucleus and combined with the promoter domain or other consensus sequence. By measuring the changing quantity of the NF - κB in the neuron after spinal cord injury , we verified nerve growth factor can promote NF - κB express as to inhibit the neuron apoptosis, then protect the injured spinal cord. This may be another mechanism which nerve growth factor protect the damaged spinal cord.Materiel: the healthy SD mice, weight 300 ± 30g, male or female ( provided by the centre of test animal, china medical university) ; RT - PCR and p65 primer provided by takara company; NGF and NF - κB p65 was purchased from Sigma company.Method1. RT - PCR A little injured and normal tissues were cut. Total RNA were distilled and PCR was conducted. The reversal transcription system was as follows: primers, 6μl 10 × buffer,1μldNTP,0.25μl RNase inhibitor were put into 1.5ug total RNA. PCR system: 4μl 5 × buffer,0.5μl primer 1,0.5μl primer2 , 0.3μl TaqTM,0.7μl ddH2O were put into 4ul RT product. The primers are as follows: p65 ( 224bp): 5 ' TGGATGGACAGGCGTTGA3 '; 5' AGACAGGAC-CTCTGAGAAAGT3 ' ; β - actin ( 696bp ): 5 ' GATTGCCTCAGGACATTTCTG3 ' ; 5 ' GATTGCTCAGGACATTTCTG3 ' ; The product was for agar gel electrophoresis. The relative quantity of each mRNA was determined by the ratio of β - actin by Bandleader software.2. immunohistochemistry dyeing:NF -κB p65 protein was dyeing by the "sp" method in the cells of the "NGF"group and "NS"group, observing the levels of the NF - kB p65 protein expression.3. observed by the electric mirror of transmission ;ten mice was needed, which was divided " NGF group" and " NS group" . The model of spinal cord injury was made followed by the above method, injured after 8,12,24,hours, the mouse was executed, the spinal was taked. the tissue was dipped in the glutaral-dehyde - Phosphate Buffer(2.5% ,PH7.2) immediately, then cutted by ultra-microtome, water by glutaraldehyde - Phosphate Buffer(2. 5% , PH7. 2) , after that, dehydrated by grads - alcohol (30% - 50% - 70% - 80% - 90% -100% ) ,in every liquid the tissue must be dipped 15 min at least, isoamyl acetate was then used, dry by carbon dioxide (CO2) , double staining by uranyl acetate - lead citrate, at last the samples were observed and taken pictures.Result:1. the change of the p65 mRNA ( messenger Ribonucleic Acid) after acute spinal cord injuredthe analysis of variance on the IOD ( integral optical density) of p65 mRNA at the normal group, the result show that there is no variance among the subgroup ; the analysis of q on the IOD ( integral optical density) , the result show that there is abvious variance among the subgroup. The maximal average absolute value of IOD is 1. 37 ± 0. 02 which is the value of injured group at eight hour, and the value is 9. 6 as times as the normal group value, which suggested that the express peak arised at eight hours after injured.2. immunohistochemistry dyeingthere is a few of dyeing cell which the NF - κB protein have translocatedfrom the cytoplasm to the nucleolus, but the dyeing is unconspicuous. the analysis of variance on number of dyeing cells, the result show that there is no variance. However, there is a lot of dyeing cell which the NF - κB protein have translocated from the cytoplasm to the nucleolus, the result show that there is abvious variance among the injured group. The time of NF - κB translocated from the cytoplasm to the nucleolus is between two hours and two weeks after injured.3. The transmission electron result; the apoptosis cell was observed distinctly in the"NS" group , the chromatin was shrink, assembled around the karyotheca, the cytoplasm condensed, the karyotheca ruffled , organelle was untouched, the number of apoptosis cells is more the the "NGF" group abviously.DiscussionNuclear factor - kB correlates closely with the acute,chronic inflammatory disease; and it was important for the survival of cell, whether the cell is survival or not is decided by the cell' s type and the different stimulus mainly. It participates in modulateing Many genes express including apoptosis gene, Immediate -early gene. NF - κB family consist of five members: RelA ( p65),Rel 3,cRel, NF - κB1 (p50/p105) and NF - κB2 (p52/p100) ,all of them are an fast reactive transcription factors which exist in cytoplasm universally, and p65/p50 het-erodimer is the classical type. Physiologically, NF - κB/Rel protein dimer and the IκB combined to Heterotrimer, which stay in cytoplasm. When stimulated by some signal, I7B kinase(IKK) phostphated IkB, the subunit of the heterotrimer, IKK is the important modulator of IγB, the phosphated IγB degraded, and heterotrimer became the heterodimer, so the heterodimer translocated from the cytoplasm to the nucleolus soon. After translocting, the heterodimer can combine with its' γB gene sequence, which induce gene express such as acute protein gene, transcription factor gene,chemokine gene, growth factor, vascular cellular adhesion moleculer gene and so on.The nerve growth factor is the only found nutritious factor so far , which act on not the central nerve cell but the periphery nerve cell. In this paper, we...