| IntroductionMycoplasma pneumoniae is a causative agent of tracheobronchitis and primary atypical pneumonia in humans. Adherence to host respiratory epithelium is a crucial step in M. pneumoniae infection and successful colonization. The P1 adhesin is a major M. pneumoniae immunogen and have antigen epitops at its COOH-terminal. P1 adhesin or its subunit might be a M. pneumoniae diagnosis reagent and vaccine candidate. In this experiment ,3'- end gene fragment of P1 adhesin was amplified from M. pneumoniae DNA by PCR. It was inserted into the vector pGEX-6P-l and sequenced . The ligated plasmid was expressed in E. coli BL21. Western blot assays were applied to determine immunoreactivity of the purified recombinant protein, which suggests that it might be a novel diagnosis reagent and vaccine candidate in the future.Methods1. PCR amplification and amplicon identification . Mp FH strain was grown and DNA template extracted according to the method describe previously by us. p1 'gene was amplified by PCR with the 5' p1 primer GTGAATTCGCGAGTGCT-TACAAGC(EcoRI) and the 3' p1 primer AGCTCGAGAAACGGACTAAACAAG (Xhol) , designed on the basis of previously published P1 gene sequences. PCR was performed in a 50 l reaction mixture by TaKaRa TaqTM PCR kit. PCR amplification was done under the following conditions: denaturation at 94 C for 5min , 20 cycles of denaturation (60s) at 94 C ,annealing (60s) at 60 C ,and extension (90s) at 721 , extension at 72 C for 5min . Amplified products were analyzed by electrophoresis on 1% agarose gels.2. Construction and identification of the recombinant plasmid . The ampli-con and pGEX-6p-l plasmid were digested with EcoRI and Xhol enzyme . Two enzyme fractions were ligated with DNA ligation kit . The ligation mixture was used to transform E. coli BL21 , which was assayed on Luria-Bertani plates containing 100 g of ampicillin per ml. Restriction enzyme analysis , PCR amplification and sequence analysis of recombinant plasmid confirmed the recombinant clone.3. Nucleotide sequencing and sequence analysis of recombinant clone . Recombinant plasmid was directly sequenced by TaKaRa Biotechnology (Dalian) Co. ,Ltd. Sequence comparisons with sequences in the GenBank and EMBL databases were made using the BLAST programs BLASTN, BLASTX, and BLASTP.4. Expression of recombinant clone and western blot. SDS-PAGE assay was performed following the manualof Sambrook et al ( 1989 ). After electrophoresis, the proteins were transferred onto a Hybond C Nitrocellulose filter. Hie Western blot analysis was performed with anti-Mp polyclonal antibodies.Results1. Agarose gel of PCR product . The PCR product is 894bp correspond with reference value.2. Indemnification of recombinant clone . The recombinant which inserted pi 'gene was used as the template to PCR amplification . We obtained a band of the same molecular weight as the pi' gene. Recombinant clone was digested with EcoRI and Xhol enzyme and generated two 4.9kb and 0.9kb bands, while recombinant clone was digested with EcoRI to generate one 5.8kb gene band. It suggests the p1 'gene exists in recombinant clone.3. DNA analysis of recombinant clone. The nucleotide sequence of the recombinant reveals 99.66% ~ 100% identity to the six reported p1 gene nucleotide sequences ( AF290001, AF290002, AF286371, AE000002, M21519, M18639). The deduced amino acid sequence is compared and shows 99.32%~ 100% homology with amino acid sequences above .4. Recombinant clone western blot. The theoretical molecular mass of the protein encoded by the cloned p1' gene was calculated to be 59 kDa by SDS-PAGE. It is identical to the theory value. Western blot shows that anti-Mp poly-clonal antibodies reacted to a major band with a molecular mass of 59 kDa . The results showed that the expression protein exists in antigen determinant.Conclusion1. We cloned the p1'gene of M. pneumoniae P1 adhesin and constructed the recombinant plasmid pGEX-6p-l - p1' which was expressed in E. coli BL21. By Western blot , the correspond... |
PDF Full Text Request