Font Size: a A A

The Role Of RdxA Gene Mutation And OMP On Metronidazole Resistance In Helicobacter Pylori

Posted on:2004-05-29Degree:MasterType:Thesis
Country:ChinaCandidate:G ZhouFull Text:PDF
GTID:2144360092490686Subject:Internal Medicine
Abstract/Summary:
Helicobacter pylori is the main cause of chronic gastritis, peptic ulcer, gastric cancer and MALT. Now due to widely use of antibiotic in clinic, the phenomena of resistance become more and more prominent, which is the important factor leading to treatment failure. Metronidazole is the important factor for success treatment to Hpylori infection and is the main gradient of new triple therapy. But metronidazole combined therapy is also restricted due to the resistance.It's difficult and complex task to clinically isolate and culture the Hpylori, which prevent susceptibility test being carried out clinically. It's necessary to detect the resistance mechanism, only based on which can we carry out the susceptibility test using biochemistry method and instruct the clinical description. Besides these, detecting the resistance mechanism may be helpful in reverting the MTZ resistance.Up to now, the resistance mechanism of Hpylori to some medicines such as clarithromycin, amoxicillin is clear, but there are many viewpoints about metronidazole resistance of Hpylori. Of particular note is the mutation of rdxA gene, which encode an oxygen-insensitive NADPH nitroreductase. The cytotoxicity of MTZ is due to the unstable and less reduced intermediates that damage DNA, resulting in strand break, helix destabilization, unwinding and cell death. But up to now, no special nucleotide sequence related with Hpylori resistance phenotype was found.We have found membrane's role in metronidazole resistance of Hpylori. In this study, rdxA genes of clinical isolates were sequenced and sequences were compared with Hp26695 sequence and the rdxA sequences reported by other researchers. Then we selected the clinical strains without rdxA gene frameshift mutation, prepared the outer membrane protein (OMP) and metronidazole polyclonal antibody. The main outer membrane proteins in sensitive and resistant strains were compared by Western Blot.Materials and methods1. Culture of Hpylori: All samples used in this study were clinical isolates from patients through endoscope biopsy. Each the sample was smeared on Hpylori selective Columbia agar plate containing 10% sheep blood. Hpylori cultures were incubated at 37℃ under microaorobic conditions. NCTC11637 was reference strain.2. Determination of minimal inhibition concentration (MIC): The MIC was determined by paper test and agar dilution method of NCCLS. Agar dilution plates were prepared with two fold serial dilution of metronidazole (sigma), ranging from 0.25 to 128μg/ml. The young exponentially growing Hpylori strains were prepared in sterile saline and adjusted to No.2 McFarland standard. About 1 to 5μl of adjusted inocula was delivered to agar dilution plate. Results were read after 72h incubation and the MIC determined as the lowest concentration of metronidazole in which no visible growth occurred. Strains the MIC value >8μg/ml were classified as resistant.3. Preparation of Hpylori Genomic DNA: Phenol-Chloroform and DNase-free RNase digestion were used for preparation and purification of Hpylori genomic DNA. The dried DNA was resuspended in 60μl TE buffer and stored at -20℃.4. PCR amplification of rdxA: The oligonucleotide primers rdxF(forward) GGGATTTTATTGTATGCTACAA and rdxR(backward) GCAGGAGCATCAGATAGTTCT were used to amplify PCR product (886bp long in total) that containing the entire 633bp rdxA gene. PCR was performed in an automated thermal cycler in a final volume of 100μl, containing 250nmol/L primers, 2.5mol/L dNTP, 15mol/L MgCl2, 2.5U Tag polymerase, 1× PCR buffer(pH8.3) and 100ng DNA template. The cycling conditions : 94℃5min, 41; 94℃30S, 50 ℃30S, 72℃60S, ×10: 94℃30S, 50℃30S, 72℃70S, ×20; 72℃10min, ×1. The result were identified by 1.5% agarose electrophoresis.5. T-A cloning and sequencing: The target DNA fragments amplified from rdxA genes were ligated to PUCm-T vector for 16h, and then transferred into E.Coli DH5a. Positive cloning containing the targe...
Keywords/Search Tags:Helicobacter pylori, rdxA gene, Mutation (genetics), Metronidazole, Drug resistance, outer membrane protein
Related items