| In this dissertation, 5 groups of CMS lines were developed by back-cross between 3 japonica lines Shen-nong315, ZK107,Zhen2-zhen, 2 indica-japonica lines (progeny of indica crossed with japonica) P13=2NPB and Ling64-qingre used as male parents (equal maintain line), respectively, and 3 CMS types WA-, K- and Dian- used as female parents. The characteristics including male sterility, flowering habit and restoring of 5 CMS groups were compared. Apart from this, a small grain rice mutant ZH-sg was genetically analyses. And the mutation gene controlling rice grain shape was mapped by molecular markers. The results were as follows:(1) The pollen fertility (I2-KI dye) and rates of self-fertility of WA-type CMS lines Shen-nong315 A, ZK107 A and Zhen2-zhen A were absolutely zero, but pollen fertility of WA-type CMS lines P13=2NPB A and Ling64-qingreA were 2% and 3%, and the rate of self-fertility of which were 0.90% and 0.98%. The pollen fertility and rate of self-fertility of K-type CMS lines ZK107 A and Zhen2-zhen A were completely zero, but pollen fertility of K-type CMS lines P13=2NPB A and Ling64-qingre A were 2% and 4%, and the rate of self-fertility of which were zero and 2.13%. Both pollen fertility and self-fertility were found in group of Dian-type CMS lines. Thus, CMS lines of WA- and K- were better than that of Dian-type.(2) The spikelets flowering of maintainers P13=2NPB and Ling64-qingre (filial generation between indica and japonica) were mostly abloom before noon, so the homologous P13=2NPB A and Ling64-qingre A were earlier than that of japonica lines Shen-nong 315, ZK107, Zhen2-zhen and relevant A lines. That implys the character of flowering habits in indica rice can be introduced into japonica rice through hybridization of indica-japonica.(3) Stigma exsertion rate of maintainer lines Ling64-qingre, P13=2NPB, Zhen2-zhen, ZK107 and Shen-nong 315 were 92.06%, 43.75%, 9.35%, 0 and 0, respectively. The stigma exsertion rate of each homologous CMS line resembled respective maintainer line. So, the character of stigma exsertion can be heritable, and the total stigma exsertion (both unilateral and bilateral glume) of progeny from the hybridization of indica-japonica was better than that of japonica rice.(4) The glume-openning angle of CMS lines in WA-type Shen-nong315 A and ZK107 A was bigger than that of P13=2NPB A and Ling64-qingre A. The same cases also appeared in CMS lines of K- and Dian-type. As referred before, pollen fertility of WA-type CMS lines Shen-nong315 A and ZK107 A were zero, but that of P13=2NPB A and Ling64-qingre A were 2% and 3%. And in K- and Dian-type, sterility of Shen-nong315 A and ZK107 A were better than that of P13=2NPB A and Ling64-qingre A. For more pollinated, CMS lines have to make their glume-openning angle of spikelet to be big enough. That was why the glume-openning angle of CMS lines of WA-type Shen-nong315 A and ZK107 A was bigger than that of P13=2NPB A and Ling64-qingre A.(5) There were 9 restorer lines that used for CMS fertility in this dissertation. Zhi-4, as a restorer, had the ability that its effect of restorative to CMS was same between WA- and K-type, but better than Dian-type. In addition, P13=2NPB A of 3 CMS WA-, K- and Dian-type could be restored by 3 restorer lines Sheng-you 2, P10-3 and ZO90-3. But these restorer lines couldn't restore the CMS lines with nuclear from Shennong315, ZK107 Zhen2-zhen and Ling64-qingre.(6) The small grain mutant ZH-sg was induced from ZH11 by gamma-ray. Genetic analysis indicated that the small grain trait was controlled by a recessive gene. Through a F2 population crossed normal grain Nei-xiang 2 with mutant ZH-sg and 108 pairs SSR markers distributed in 12 rice chromosomes, the mutation gene sg(t) was located between marker RM12368 and STS marker (ATGTGTGCTTCGGTCGTGAT, TTCTCACATCTGAACCTCTCC) on Chromosome 2. |
PDF Full Text Request