Flowers play an important role in our lives and the flower color has great ecological significance. The study of plant genetic engineering to change flower color can help us to study gene expression regulation and interaction. Flower varieties with new flower color are highly cost-effective.Expression of structural gene and regulatory gene of procyanidins metabolic in plant cells resulting in the accumulation of anthocyanin which cause the flower color changes. The changes are easy to be observed, it can be used very conviniently to study on gene expression,regulation and interaction, especially to the research of gene inhibiting and gene silencing.A fragment of a putative chsgene about 1432bp was cloned from Arabidopsis thaliana a common garden plant belonging to the Cruciferae family, using the primers (5'-CCGTCCATCTAACCTACCACACTC-3', 5'- CTGTTTAGAGAGGAACGCTGTGC -3'). The gene was inserted in procaryotic expression vector and eucaryotic vector pBI121 which contains CaMV 35S promoter in sense and anti-sense orientation. chs gene was highly expressed in procaryotic expression system. The tobacco leaf discs were transformed by A grobacterium tumef aciences LBA 4404. Not only the flower color of transgenic plants was altered but the leaves' color of the transgenic plants was thin. Moreover, the length of flower's pistil and stamens were changed by transgene. The effect of sense transgenic expression is significant than the anti-sense transgenic expression, some flower of the sense transgenic tobacco even show the white color. It is more important that the semi-quantitative RT-PCR result shows that the level of chs expression in transgenic tobacco is significant lower than that in the wild type. |