| Aim:Ticks are obligate ectoparasites that infest domestic animals and fowls. They are the significant vectors transmitting a great number of pathogens of human and animals, such as arboviruses, rickettsiae, spirochetes and parasitic protozoa,which causes not only a great economic loss,but also a mass challenge to stockbreeding production and populatio-nal health.At present, about 100 kinds of tick were found in china, Hyalomma asiaticum tick is a predominat kind of ticks in norstwest of china, which mainly transmit Crimean-Congo hemorrhagic fever.Current tick control methods depend heavily on the use of chemical acaricides. However, the accompanying problems of resistance to the acaricides and the presence of chemical residues in meat and milk show the need for alternative control methods. Immunological protection of mammalian hosts against tick infestation has been proposed as the most sustainable alternative tick control method comparing to the use of acaricides. On the other hand, the success of this method is dependent on the identification of key molecules for use as tick vaccine antigens. So in this study ,we aimed to clone , express and characterize of two new genes from a subtraction cDNA library of mRNA from a hard tick--- Hyalomma asiaticum tick's salivary gland, which was constructed based on genes expression difference in it between unfed and half engorged, respecting to the search of tick molecules for vaccine candidates.Methods and Results: Firstly,we used biosofts to analysis two EST sequences(we named after 1-6 and B12 based on sequenced lists).The results shows one (1-6) is a complete gene,which contains an open reading frame of 510 bp that codes for 170 amino acid residues with a coding capacity of 18.36Kda,so we named it as AP18 ;The other (B12) has a typical poly(A) tail in 3' ends but no 5' ends, so gene special primers which were used in 5'-RACE amplification were designed based on the sequence of 3'-end:GSPl=5' —TGTACTGGAGCATGCAC—3', GSP2=5' —GAGCACACCGGGTCAGGTCCTTG —3', GSP3=CTTCATCTCGTTGG GTGATC—3', the PCR products of 5'-RACE were purified, linkaged, transformed and sequenced. Gene special primers which were used to amply full length of genes were designed based on the sequence of 5'-end, upstream:GSPl=5' -CAATCCAGTGTCGAAACATGCGC-3', dowmstream:GSP2=5' -ACGCTACTT CTGCGAACGCC-3' , the products of PCR were finally sequenced and identified, then the full length of the genes were learned. The full length contains an open reading frame of 728 bp that codes for 243 amino acid residues with a coding capacity of 27.28Kda,so we named it as AP27. We tried to analyse two gene's function in the biosoft and bioinformation website, the results shows AP18 is probably anticoagulant peptide and AP27 is likely to be concerned with transtript of gene.What's more,which are both new gene.Secondly, the natural Expression of AP18 and AP27 in ticks were analysised by the... |