Sugarcane smut caused by Ustilago scitaminea Syd. is one of the most important disease in sugarcane. It has spread out all over the world and causes serious loss in stalk yield and sucrose content in susceptible varieties. Cultivation of resistant varieties was the most effective measure. By the time, identification of sugarcane smut resistance was still conducted by artificial inoculation and cultivation in the field. It must be conducted in two crops of plant cane or one crop of plant cane with one crop of ratoon. It is time consuming and land consuming. So, it was difficult to screen a plenty of materials by this method. Also, the results of identification will be affected by environment. Selection of smut resistance in early generation is impossible. Based on a basis of genomic DNA, molecular-assisted selection (MAS) is more efficiency and accuracy for identification and selection.The purpose of the research is to develope a SCAR marker for detection of sugarcane smut resistance. First, optimization of RAPD in sugarcane was conducted. Then, two pieces of polymorphic fragment amplificated by random primer were screened. One was 700bp and another was 800bp. The fragment of 700bp linked to sugarcane smut resistance gene was cloned by T-MD 18 vector. Clonies were identificated by PCR amplification and restriction digest. Positive recombinant clone was used for sequencing. The polymorphic fragment is 702bp according to result of sequencing. Based on the base sequence, a pair of primer P1 and P2 was designed. A fragment of about 700bp was amplificated by the pair of primer in either resistant or susceptible genotypes, but a polymorphic fragment of about 400bp was amplificated only in susceptible genotypes. The tested material included crossing parents, some of crossing segregants and standard varieties used in conventionally artificial inoculation. So a RAPD marker was converted to SCAR marker and it would be used for identification of sugarcane smut resistance. The followings are the sequences of primers used in SCAR marker.Upstrait primer (P1): 5'TTCCCCCGCTGCCCTCTTTTCTT3' Downstrait primer (P2): 5' TTCCCCCGCTCGGACACCTGTT 3'... |