Study On The Method Of Testing Transfer Bt Gene Insect-Resistance Cotton Seeds With PCR

Nine cotton varieties had been used in this experiment. The study concentrated on the DNA extraction method, PCR reaction system and screening of the specific primer. The results were the base for the testing transgenic cottonseed purity in the future. The results were as followed:(1) An efficient procedure had been developed for DNA extraction from the cottonseed based on PCR. ① Grinded the seed sample with normal temperature and transfer the powdered seed to a 1.5ml tube.②Added 10 times(ul/mg) preheated extraction buffer(100 mM Tris-HCL, 1.5% SDS) to the sample, incubated the mixture at 70 ℃ 10-50min in the water bath with periodic shaking. ③ Added equal volume Phenol-Chlorform at room temperature and mixed by inverting the tubes for 1-2 min.④ Centrifuged for 10 min at 8000rpm at room temperature to separate the phases. The supernatant was used to amplification as DNA template.(2) A better protocol had been sstablished with the unpurified DNA extraction liquid. Cycle parameters: pre-denature 2min at 94℃, denature 40s at 94℃, anneal 40s, extend 50s at 72℃, 30 cycles, extend 5min at 72℃. Amplification system: 2.5ul 10XBuffer, 1.5ul Mg2+(25mM), 1ul dNTP (2.5mM), 0.2ul TaqE (5U), 0.5ul Primer(20pmol/ul), lul DNA about 60ng, H2O 17.8ul, total volume: 25ul.(3) We had found four sets of specific primers used for testing of the transgenic insect-resistance cotton;① Primers base on 35SPrimer 1 5' -CCATCATTGCGATAAAGGAAA--3' Primer2 5' - GTCTTGCGAAGGATAGTGGG - 3'② Primers base on 35s and Bt gene Primer3 5' - CATCATTGCGATAAAGG - 3' Primer4 5' - CTAGAGATGGCCTGGTT - 3'③ primers base on Bt genePrimer5 5' - C ACAGTTTCTGCTCAGCGAGTT - 3' Primer6 5' - CTGGAGTCATAGTTCGGGAAG - 3' ④ Primers base on Bt genePrimer7 5' - GGGCCCGCTGAATCCAACTGGAGAGGC - 3' Primer8 5' -CCATACAACTGCTTGAGTAACCCAGAAGTTG-3' (4) We have tested the transgenic cottonseed purity with PCR method. The samples were 94% and 92% separately by PCR testing.