| In order to make aim gene expressed timely, measurably and effectively in transgenic plants, gene expression system was established by an effective gene switch erected in the upper of expressed aim gene to realize artificial controls for gene expression.That is main effective means to control aim gene expression.Most study on gene transcription by external inducers at present,but this method connot be indicated completely in some plants species. Gene was transcribed when The heat shock promoter was activated by high temperature.It is safer for plants and environment in external inducers than other inducible promoters.Arabidopsis is the model plant for molecular biology and genetic engineering because it is small in size,low repetitive DNA,short growing period et.al.The abounded research achievement and document about Arabidopsis have referential significance.The promoter fragment of AtHSP70b was cloned by PCR method from Arabidopsis thaliana genomic DNA.Through nucleotides sequential analysis,specific component element was modified,then modified heat shock promoter HSP70m, was synthesized.It is of great importance in artificial control and expression for plant gene.The main research contents are as follows: The cloning,sequencing and analysis of heat shock promoter AtHSP70b.Design, synthesizament and sequencing modified heat shock promoter HSP70m. The construction of middle vector and plant expression vector.Genetic transoformation of Tobacco and tomato.Transgenetic plants were identified by molecular analysis.Functional analysis of promoter and the determination of the induction temperature.The main results are as follows.1 The cloning,sequencing and analysis of heat shock promoter AtHSP70bAccording to the sequence of the promoter fragment of heat shock promoter AtHSP70b,two specific primers,Priml (TATATCCCGGTCGGTGAATC) and Prim2 (GGAAGTGAGGTTTTTCGATTTC) were designed.Target fragment AtHSP70b from Arabidopsis thaliana Columbia DNA was amplified by PCR with high fidelity pfu-DNA polymerase.The PCR products were purified and cloned into pMD18-T vector then pMD-AtHSP70b was constructed.By white-blue screening,clony PCR and enzyme digest analysis,the result showed the plasmid containding AtHSP70b fragment was transferred into E.coli XL1-Blue.The sequencing of the single recombinant bacterium contaning the inserted AtHSP70b fragment was carried out by Sangon Bio-engineering CO.Ltd.The result showed that the fragment was 204bp,the same as the sequence of AtHSP70b isolated from Arabidopsis thaliana.2. Design, synthesizament and sequencing modified heat shock promoter HSP70mThrough analysing the heat shock promoter AtHSP70b,modifing imperfect HSE into perfect HSE (nnGAAnnTTCnnGAAnn) and eliminating the cis-element,HSP70m was synthesized.The connection of artificial systhesis promoter and the fragment of -46 mini 35S:GUS from pSAU2006 cloned into pMD18-T vector then pM-HSP70mGUS5 was constructed.By white-blue screening,clony PCR and enzyme digest analysis,the result showed the plasmid containding AtHSP70b fragment was transferred into E.coli XL1-Blue.The sequencing of the single recombinant bacterium contaning the inserted HSP70m fragment was carried out by Sangon Bio-engineering CO.Ltd.The result showed that the fragment same with the sequence of HSP70m designed.3.The construction of plant expression vectorAfter pMD-AtHSP70b plasmid with target fragment AtHSP70b,pM-HSP70mGUS5 plasmid with target fragment HSP70m and vector plasmid of pSAU2006 were double-digested by EcoR I +Xba I ,the target fragment were collected and purified respectively,after being ligated,middle vector pM-HSP70bGUS and pM-HSP70mGUS.Plasmid pM-HSP70bGUS, pM-HSP70mGUS and vector plasmid of pVCT2020 were double-digested by EcoR I +HindIII,the target fragment were collected and purified respectively,after being ligated,then plant expression vectors pV-HSP70bGUS and pV-HSP70mGUS were constructed.4.Research on AtHSP70b-GUS and HSP70m-GUS gene genetic transformation of tobacco.The leaves of tobacco were used as explant material,inoculated respectively with Agrobacterium of LBA4404(pV-HSP70bGUS in LBA4404 and pV-HSP70mGUS in LBA4404),cultured for 2 days in dark.Through culture induction and resistance selection,callus and adventitious bud induction growed.The adventitious bud induction cultured on rooting culture(solid culture medium with MS + 0.2mg/L NAA + sucrose 30g/L + agar 7.0g/L + 300mg/L Cb + 150mg/L Kan).The Kan-resistant plants of transgenic tobacco were regenerated.The transformant plants were assayed by PCR amplification,with two double primers Pl(according to Promoter of AtHSP70b and HSP70m) and P6.The target bands with 673bp and 586bp were observed respectively form DNA of regenerate plants,so the integration of the AtHSP70b-GUS and HSP70m-GUS gene into tobacco genome DNA were confirmed.5. Expression of AtHSP70b and HSP70m in tobacco and activity analysis by heat shock. Two genetic tobaccos induced in different temperature,and then GUSAssay-hestochemical.The results showed that The activity of AtHSP70b increases with the increase of test temperature.But the promoter AtHSP70b expressed in different degree at ordinary and low temperature 4℃.The activity of HSP70m increases with the increase of test temperature in the range of 29℃~38℃.That showed artificial heat shock promoter HSP70m expressed precisely induced by heat temperature.It has very strong value for artificial control and expression of target genes.6. Study on transformation of plant expression vector LBA4404 (pV-HSP70mGUS in LBA4404) into tomato.The leaves and stem of tomato were used as explant material,inoculated with Agrobacterium of LBA4404(pV-HSP70mGUS in LBA4404)for 8~10 minutes,cultured for 2 days in dark,postcultured for one week on culture medium with appended Cb 300mg/L,transformed to screening-culture medium with Kan 50mg/L to screen resistant callus and resistant bud,changed fresh medium every two weeks,resistant bud was transformed into the culture medium for seedling's growth to be cultured for 1~2 weeks,and then to the rooting culture medium,the Kan-resistant plants of tomato were regenerated. |