| In order to study on chicken gene of chicken genome.Laihang chicke was taken as research object in this experiment.Thirteen kinds ofβ-denfensin gene in chicken have been successfully cloned and sequence analysised by molecular cloning technolgy.Gal-4~Gal-12 gene sequence have been reported first time internal.The thirteen genes' distribution in brain,heart,,kidney,lung,liver,spleen,bursa of Fabricius and marrow has also been investigated.Based on the Escherichia coli gene expression principle,maltose-binding protein expression system pMAL-c2X was used to successfully construct Gal-2 gene prokaryotic expression vector.All the done work above has provided rationable for further comprehension of defensin's biological function and exploitation of new antibiotics.The result as follow:1 Clone and tissue distribution of Gal-1~Gal-13 in chickenTrizol Reagent was adopted to extract the RNA of chicken's brain,heart,bursa of Fabricius,spleen,kidney,lung,liverand marrow,28S and 18S RNA bands were found by 2.0%agarose gel electrophoresis,it showed that extracted RNA could be used for RT-PCR extension;The OD values of RNA at wavelenghs of 260nm and 280nm were determinated by spectrophotometer,The ratioes between the readings at 260nm and 280nm(OD260/OD280)were all about 1.9.The results suggested that the purity of obtained RNA was high enough to satisfy the following experiment.According to the gene sequence of Gallinacin-1~Gallinacin-13 registered in Genbank,thirteen pairs of primers were designed respectively.RNA from the tissues was reverse transcribed with random primers and SuperscriptⅡreverse transcriptase by using a first-strand cDNA synthesis kit(Promega)according to the instructions. The subsequent PCR was carried out with the first-strand cDNA and gene-specific primers for Gal-1~13.The gel electrophoresis showed that specificness strap could be seen in the figure of Gal-1~Gal-12.The sequenced result were the same as the reported sequence,all the homology rate were all more than 95%.All of the cloned sequences comprised complete reading frame that got ready for the next amplification by nested PCR.In able to summerize tissue distribution information of 13 species of defensin,the PCR was carried out with the first-strand cDNA which were reverse transcripted from RNA that were extracted from 8 kinds of tissue and gene-specific primers of Gal-1~13.Gal-1~Gal-12 were found in 8 tissues,Gal-13 hasn't been found in the above tissues.Gal-1~7 were in marrow,Gal-9~11 were in kidney,Gal-1 and Gal-8~ 10 were in liver,only Gal-5 was in brain,only Gal-12 was in heart,Gal-1 and Gal-3 were in bursa of Fabricius,only Gal-1 was in spleen,Gal-1~3 and Gal-10 were in lung.The result showed that there were variety and individual differences in defensin distribution,so further research was significance.2 Clone,identification and expression of Gal-2 gene in chickenRT-PCR products of Gal-2 gene in chicken were purified,then were inserted in multiple cloning sites of pGEX-T easy plasmid vector,formed recombinant pGEX-T-Gal-2 plasmid,which was then transformed into E.coli DH5α,positive clone plasmid was screened with Amp resistance screening and colony PCR.A specificness strap of 195 bp hasd been obtained.A pair of primers to amplificate Gal-2 gene was designed.Upstream primer:GCGAATTCCATGAGGATTCTTTACC contain a EcoR I enzyme site;downstream primer:GCTCTAGATCATGCATTCCAAGGC contain a Xba I enzyme site and reciprocal protected basic group.RT-PCR products of Gal-2 gene were inserted in pMAL-c2X plasmid vector which was double enzyme cutted by EcoR I enzyme and Xba I enzyme,formed recombinant pMAL-c2X-Gal-2 plasmid expression vector.In order to confirm the presence of foreign gene,positive recombinant plasmid was identified with EcoR I,Xba I double enzyme cutting,the electrophoresis results demonstrated that the anticipated size(195bp)gene fragment was obtained;and was appraised by PCR,specific band about the 195bp size was found with the electrophoresis.These results suggested that the Gal-2 gene was inserted to pMAL-c2X plasmids and recombinant expression plasmid was constructed successfully.Following induction with IPTG,SDS-PAGE detection.The above results showed that:the new type of antibacterial peptide-defensin were suceffully cloned by modern molecular technology,densin distribution in chicken's tissue was also be studied.On the base of successfully being cloned Gal-2 was successfully inserted into pGEX-T clone vector and pMAL-c2X expression vetor. |