| In this experiment, three pairs of PCR primers special respectively to mouse, human and bovine were schemed out according to the analysis on the core sequences of SRY/Sry genes of those mammal species. The rates of amplifying Sry of mouse white blood cells were respectively 96.7%, 86.7% and 26.7%, and the two formers do not differ (p>0.05), but do from the last one (p<0.05). The pair of primers with the best result was the first one special to the mouse, whose sequences were 5'GGCTACTTACGGAAGTACCAC 3'(Sryl) and 5'GCCTATGAAGAGCGCCACGTC3' (Sry2). This pair of primers were used to amplify Sry gene of white blood cells of male mice with density of Mg2+ respectively as 10mmol/L, 15mmol/L, 25mmol/L and 30mmol/L, with the mating rates being 30%, 60%, 100% and 100%, and the two formers are obviously lower than the last two ones (p<0.05). The numbers of cycling were designed respectively as 25 , 36 and 50, with almost the same results emerging, but the best one was 36. The product of PCR was examined to have 192 bps, 98.4 percent of which is the same as the core sequence of Sry gene of the mouse (p>0.05). 12 parthenogenesis embryos were discriminated under the selected PCR system, with none special proliferating ribbon appearing, proving the accurate rate to be 100%. Randomly selected embryos of 8 cells, 16 cells, mulberries and blastocysts were examined by PCR, and the positive rates were respectively 13.3%, 36.7%, 46.7% and 43.3%. All do not differ from the theoretical 50% (p>0.05) except the 8-cell ones (p<0.05). |