Dairy cattle DNA was isolated from peripheral blood with three extracting methods, and two pairs of primers according to the conserved region of WAP gene in rabbit, camel and swine which are of closely evolutional relation were designed , i.e. sequence 1, forward primer: 5 ' -ccaccatgcgctgtc-3 ' , reverse primer: 5 ' -cggctgtgtccctg-3' , sequence 2, forward primer: 5' -gtgccaacgacatcg-3' , reverse primer: 5' -ttcactcacccacatcc-3' , 241bp and 183bp fragments were amplified by PCR respectively. The two fragments are 40bp and 22bp longer than the corresponding sequences of rabbit respectively. This maybe related with the evolution of ancestor "WAP"gene through gene duplication and divergence, chromosome or exon/domain shuffling etc. Sequence 1 has three motifs of (Trans)glycosidases ,i.e. CCTGGAAGGTGTT(107bp~120bp),CAGGTGGTTCTCG(125bp-138bp),CTGCTCTA GTGTTCCAGGG(213bp~232bp) and a motif of Alkaline phosphatase-like,i.e. CATGCGCTGTCCTC (4bp~18bp) .Its percent identities are 55.4%,45.1% and 46.7% compared with the corresponding sequences of rabbit ,swine and camel respectively and 61.963% with interferon-alpha mRNA of bovine. Sequence 2 has a motif of Citrate synthase, i.e. GGTGAGTGCCCATGGGCCAGGCCGGA(14bp-40bp). The amino acid sequence analysis of different animals implied their great aberrance by DNAstar software. WAP, Four-disulfide core domains analysis show that WAP has been evolved into Trappin-2 in bovine by BLAST software. The result demonstrated that the WAP DNA sequence varied great so that it probably disappeared or turned into some sequences with low percent identity, such as the motifs of (Trans)glycosidases , Alkaline phosphatase-like , Citrate synthase, Trappin-2 in bovine and follistatin in sheep. Therefore, we conclude that rWAP promoter region(6.3kb) can be used to regulate the backward heterozygous gene to highly express the corresponding protein in the mammary gland of transgenic domestic animals ,esp. ruminant ,such as bovine and milk goat.
|