| Trichagalma formosana(Hymenoptera:Cynipidae),Principal harm Quercus variabili,which is the largest known species of Cynipini.Mitochondrion are important organelles of organisms,and the data of insect mitochondrion genome are widely used to study molecular evolution,phylogeny and population genetic.In this study,mitochondrial COX1 gene variation was detected by PCR in the population of T.formosana Luan,Anhui Province.The expression of COX1 gene was analyzed by reverse transcription of RNA into cDNA.The whole mitochondrial genome was sequenced and annotated by primer step method.Specific primers were designed to investigate the small cyclization of T.formosana mitochondrial genome.The main results are as follows:1.The sequencing results of the T.formosana COX1 gene PCR products were all multi-peaks,indicating heterozygosity.The COX1 gene of 40 adult insects was sequenced by monoclonal sequencing and 1658 DNA sequences were obtained.There were 244 variable sites and 413 conserved sites in the 667 nucleotides of COX1 gene.Among the 223 amino acid sequences encoded by the gene fragment,90 were variable and 129 were conserved.According to the standard of genetic distance greater than 1.5%,there were multiple COX1 genotypes in a single T.formosana,and each individual contained 4 to 14 genotypes.A total of 73 COX1 genotypes were obtained from 40 individuals.The average genetic distance between genotypes was 7.8%,and the maximum genetic distance was 14.7%,which was much higher than the level of intraspecific variation.According to the representative COX1 genotype sequence,specific probes were designed for fluorescence in situ hybridization,which showed that they were located in the cytoplasm,rather than the pseudogenes transferred to the nuclear chromosomes of the T.formosana.In conclusion,the mitochondrial COX1 gene variation level was high,and there were abundant COX1 gene polymorphisms in both population and individuals.The occurrence frequency of mitochondrial COX1 genotype in T.formosana from 2014 to 2021 was analyzed.The genotypes and frequencies were different in different years,but some genotypes,such as C2,C16,C23,C37,C40,C44 and C55,could be detected in all years and maintained high abundance.At the same time,COX1 genotype was detected in the mature oocytes of the adult T.formosana and its maternal muscle tissue.COX1 genotype polymorphism was also found in the oocytes,and the same genotype was found in multiple maternal muscle tissues.These results indicate that the COX1 gene variants are different from mitochondrial gene heterogeneity,and are not affected by the bottleneck effect of maternal genetic material mtDNA in oocytes during reproductive process,and the polymorphism of COX1 genotype is stable in population and individuals.2.Total RNA was reversely transcribed into cDNA,and the expression levels of COX1 genotypes were detected.The results showed that there was a single dominant expression COX1 genotype and some other genotypes were also slightly expressed,but the expression level was much lower than that of the dominant expression genotype.A total of 10 major COX1 genotypes were detected from 26 individuals,namely C2,C14,C15,C16,C19,C23,C37,C40,C63 and C67.The major expression COX1 genotype is different among some individuals,and the major expression genotype in the same individual is not necessarily equal to the genotype with the highest frequency of monoclonal sequencing.The expression pattern of COX1 genotype in mature eggs was consistent with the above results.3.Complete mitochondrial genome was sequenced from 28 individuals of T.formosana using primers step transfer method.There were 13 protein-coding genes(PCG),22 transfer RNA(tRNA)genes,2 ribosomal RNAs(rRNA),and two non-coding control regions(CR)in each individual.Complete mitochondrial genomes with sequence lengths ranging from 18043 to 20682 bp,which were consistent with the characteristics of the typical mitochondrial genome of Cynipini.The sequence length of PCG,rRNA and tRNA genes,the sequence of gene arrangement and the sequence length of some gene spacer regions were completely consistent among complete mitochondrial genomes.However,13 PCG genes and 2 rRNA genes had inter-individual variation,especially NAD1,COB,COX1 and ATP6 genes,and the average inter-individual genetic distance was about 2%or higher,and the variation of some genes was greater than the inter-specific variation level.In addition,the COX1 genotypes within each complete mitochondrial genome were identical to the dominant expression COX1 genotypes in the individual.These results indicated that although there were significant polymorphisms in COX1 gene,COX1 gene was normally expressed only in the complete mitochondrial genome(including CR region of replication and transcription initiation sites).Compared with other gall wasp species,the gene spacing non-coding region of the complete mitochondrial genome of T.formosana was longer.Among the 28 complete mitochondrial genomes,7 gene spacer regions had great variation and great difference in sequence length,which was called the highly variable gene spacer region V1 to V7.However,in all complete mitochondrial genomes,except V5,the highly variable gene interval region contains the "ATATAT..." short repeat sequences with varying length.4.A total of 35 minicircular mitogenomes of 6 types were obtained by PCR amplification with specific primers from 3 individuals of T.formosana.Types Ⅰ and Ⅱcontain only COX1 genes,while types Ⅲ to Ⅵ contain trnV-NAD3,trnV-trnR,trnV-trnH,and trnL1-trnH genes,respectively.The small ring mitochondrial genome contains a variety of COX1 genotypes,and the COX1 genotype can be the non-dominant expression genotype or the dominant expression genotype of the individual.It can be seen that the mitochondrial genome was fragmented.In addition to the complete mitochondrial genome containing 37 genes and 2 CR regions,there were also various small ring mitochondrial genomes containing some genes in the same T.formosana individual.5.The cyclization model of 6 types of small ring mitochondrial genome was constructed.The genome structures of small ring mitochondrial genome types Ⅲ-Ⅵare as follows:Several genes+part of the gene interval highly variable region of the complete mitochondrial genome+part of the short repeat sequence of "ATATAT"+part of another gene interval highly variable region of the complete mitochondrial genome are cycled between the two gene interval highly variable regions by the mediation of the "ATATAT" short repeat sequence "connector".The small ring mitochondrial genome types Ⅲ-Ⅵ were formed.Specifically,mitochondrial DNA cyclization occurs between V2 segment B and V4 A for type Ⅲ,between V2 segment B and V6A for type Ⅳ,between V2 segment B and V7 A for type Ⅴ,and between V1 segment B and V7 A for type VI.Small ring mitochondrial genome type I and II respectively contain "GAAAAGATAATTGTTTAATATTAAAATTTAATTTTA" or"TATAAATAAT ATACTAATT" noncoding short clips,and accordingly with the individual complete mitochondrial genome sequence is completely consistent,Such noncoding conserved sequences are "mediators" of their small cyclization.It can be considered that there may be frequent gene recombination between complete mitochondrial genome and small ring mitochondrial genome.Some genes of the complete mitochondrial genome can be fragmented into small ring mitochondrial genomes of types Ⅰ to Ⅵ,and conversely,small ring mitochondrial genomes can be recombined into complete mitochondrial genomes.In conclusion,there are abundant COX1 gene polymorphisms and stable heritability in both population and individuals of T.formosana.The complete mitochondrial genome DNA molecules in the same body are homogeneous,but there are variations in PCG and rRNA genes between individuals.In addition to the complete mitochondrial genome containing 37 genes and 2 CR regions,there were also various small ring mitochondrial genomes containing some genes,but only the genes located in the complete mitochondrial genome(such as COX1)could be expressed normally.The diversity of mitochondrial genes is maintained in a unique way,which can provide the genetic basis for improving its adaptability to the environment.The results can provide a new perspective for the study of insect mitochondrial evolution. |
