Role And Mechanism Of FLNa And UCP2 In The Development Of Cervical Cancer

Background:Cervical cancer(CC)is a common malignant gynaecological tumour.In 2015,worldwide data showed that CC was the second most common type of cancer(second only to breast cancer)among women in developing countries[1].In 2018,according to data,CC was the fourth leading cause of cancer mortality after breast cancer,lung cancer,and colorectal cancer[2].In China,the prevalence of CC is 28.2 per 1,000 women aged 30-44 years[3].Given the prevalence of CC,identifying improved treatment methods for patients at different stages is important.One important reason is that patients with precancerous lesions in early screening stage are not accurately diagnosed and and timely treated.When the patient is in the precancerous stage of cervical cancer,in the face of such a large population,how to improve the detection rate of cervical cancer is an important problem we face.The existing molecular markers for the diagnosis of cervical lesions are not perfect,so we need to explore more molecular markers with more reference value to be used as shunt indicators to identify the lesion level.In addition,in the face of patients with cervical cancer who have been clearly diagnosed,how to get better treatment for patients at different stages is another important issue we face.Early CC(stage IA and IB1)is usually treated with surgery,and advanced CC(stage ?B-?)is usually treated with non-surgical options.For intermediate-stage CC(stages ?B2-?A)[4],no consensus on the optimal treatment has been established,and the majority of patients undergo surgery or radiotherapy;however,currently available tests cannot reliably predict risk factors in these patients.If such patients undergo surgery and risk factors are confirmed during the operation,radiotherapy will be required after surgery.Numerous studies[5-9]have demonstrated a high incidence of complications following radical surgery combined with radiotherapy.Every effort should be made to avoid radical surgery combined with pelvic radiotherapy.These patients are not recommended to receive surgery,and at-risk patients may benefit more from chemoradiotherapy.Proper preoperative selection of non-surgical treatment over unnecessary surgery will greatly improve the prognosis.[6,8-10]Hence,high-risk predictors must be identified to enable stratified management.Filamin A(FLNa)can be used as a predictor of chemotherapy sensitivity and as a biomarker of prognosis[11],and uncoupling protein 2(UCP2)can be used as an indicator of chemotherapy sensitivity in patients with advanced CC[12].Therefore,the main research direction of this study was the role of FLNa and UCP2 in the development and development of cervical cancer,so as to further explore their roles in early diagnosis and prognosis prediction of cervical cancer.The research content in the following three parts:1.Expression of FLNa and UCP2 in cervical tissues;2.Study on the influence of FLNa and UCP2 on the biological behavior of cervical cancer cell lines in vitro and its mechanism;3.Effects of FLNa and UCP2 on tumorigenicity of nude mice with cervical cancer cells.Part ?:Expression of FLNa and UCP2 in cervical tissue Objective:To detect the expression of filamentin A(FLNa)and uncoupling protein 2(UCP2)in patients with cervical cancer,and their relationship with clinicopathological factors and clinical prognosis.Detection of FLNa and UCP2 in human cervical cancer cells(C33A,SiHa,HeLa,CaSKi,ME-180,HH-8)and control cells and human normal cervical epithelial cells(HUCEC)were performed to screen out two highly expressed cells,SiHa and HeLa,for subsequent experiments.Methods:We performed immunohistochemical staining in paraffin sections of cervical tissue,including 33 NC,33 cases of LSIL,40 cases of HSIL,and 45 cases of CC(Age 47.51±11.41 years).The expression levels of FLNa,UCP2,P16 and Ki67 were determined by immunohistochemical staining to understand the expression of FLNa/UCP2 in normal cervix and cervical lesion tissues,as well as the expression of P16 and Ki67 in cervical carcinoma and high-grade intraepithelial neoplasia tissues,The chi-square test and Fisher's exact test were used for statistical analysis.P<0.05 was considered statistically significant.Analyze the relationship between FLNa/UCP2 and clinicopathologic factors associated with cervical cancer,and different expression of FLNa and UCP2 in CC and HSIL and its clinical significance.Human cervical cancer cells(C33A,SiHa,HeLa,CaSKi,ME-180 and HH-8)were selected for preliminary experiments,and two highly expressed cells SiHa and HeLa were screened out for subsequent experiments.Immunofluorescence was used to detect the localization of FLNa and UCP2 in cervical cancer cell lines.Results:1.Histopathological results1.1.Correlations between the expression of FLNa and UCP2 in CC tissue and clinicopathological factors:As described above,the expression levels of FLNa and UCP2 in CC were rated as the product of the quantitative score and staining intensity(n=45).The range of scores was 0 to 12,and 0-1 was rated as negative and>2 as positive.The median score of each protein in the tissues was used as the threshold to separate low expression from high expression.No significant correlation was observed between the expression level of FLNa in CC and age(P=0.714),tumour size(P=0.092),tumour differentiation(P=0.317),clinical stage(P=0.828),lymph node metastasis(P=0.780),or histology(P=0.115)(P>0.05).No significant correlation was observed between the expression level of UCP2 in CC and age(P=0.345),tumour size(P=0.270),tumour differentiation(P=0.092),or histology(P=0.899).However,a significant correlation was observed for clinical stage(P=0.016)and lymph node metastasis(P=0.039)(P<0.05).1.2.The expression of FLNa and UCP2 in NC,LSIL,HSIL and CC tissue:The positive rate of FLNa was 8/33 in NC,19/33 in LSIL,29/40 in HSIL,and 39/45 in CC,indicating a rising trend across these groups.A significant difference was observed between CC and NC,LSIL or HSIL(P<0.01);The positive rate of UCP2 was 0/33 in NC,3/33 in LSIL,2/40 in HSIL and 10/45 in CC.The rate was significantly higher in CC than in NC and HSIL(P<0.05).No significant difference was observed between NC,LSIL and HSIL.1.3.The expression of four immunohistochemical indicators,FLNa,UCP2,P16,and Ki67 in CC:(1)Expression in CC:FLNa and UCP2 were mainly stained in the cytoplasm of CC,as brown or dark-brown particles.The positive rate of FLNa was 86.7%(39/45);for UCP2,it was 22.2%(10/45).P16 was expressed in the nucleus,as brown or dark-brown particles,and its positive rate was 97.8%(44/45).Ki67 was expressed in the nucleus,as brown or dark-brown particles,and the positive rate was 100%(45/45);(2)Comparison of positive expression rates of FLNa,UCP2,P16 and Ki67 in cervical carcinoma and HSIL tissue:In CC,the expression of FLNa was significantly higher than that of HSIL,and the difference was statistically significant(P=0.005);The expression of UCP2 was significantly higher than that of HSIL,and the difference was statistically significant(P=0.023);The expression of P16 was slightly higher than that of HSIL,and the difference was not statistically significant(P=0.917);The expression of Ki67 was slightly higher than that of HSIL,and the difference was not statistically significant(P=0.471).Compared with P16 and Ki67,the molecular markers for diagnosis of cervical lesions,FLNa and UCP2 were significantly higher in cervical cancer patients than HSIL during the progression from cervical HSIL to cervical cancer,which could play a good shunt role;(3)Correlation of expression between FLNa,UCP2,and P16 in CC and HSIL tissues:In CC,both FLNa and P16 were positively expressed in 39 cases,and neither was expressed in 1 case,indicating positive correlation(P<0.01).Both UCP2 and P16 were positively expressed in 10 cases,and neither was expressed in 1 case,indicating positive correlation(P>0.05);In HSIL,both FLNa and P16 were positively expressed in 29 cases,and neither was expressed in 2 cases,indicating positive correlation(P>0.01).Both UCP2 and P16 were positively expressed in 2 cases,and neither was expressed in 2 cases,indicating positive correlation(P>0.05);2.Results of cell research:2.1 Human cervical cancer cells(C33A,SiHa,HeLa,CaSKi,ME-180,HH-8)and normal cervical epithelial cells(HUCEC)were all expressed with different expression levels of filaminoprotein A(FLNa)and unbinding protein 2(UCP2).SiHa and HeLa were two typical highly expressed cells;2.2 Immunofluorescence showed that FLNa and UCP2 were present in the cytoplasm of SiHa and HeLa cells.Conclusion:1.FLNa and UCP2 can be used for early diagnosis of cervical cancer,and UCP2 can be used as prognostic indicator.FLNa and UCP2 plays an important role in the diagnosis of cervical cancer and high-grade intraepithelial neoplasia;.2.There were differences in the expression of normal cervical cells and different cervical cancer cells,and the expression of cervical cancer cells was higher than that of normal cervical cells;SiHa and HeLa are two typical highly expressed cells.FLNa and UCP2 were found in the cytoplasm of SiHa and HeLa cells.Part ?:The effect of FLNa and UCP2 on the biological behavior of cervical cancer cell lines in vitro and its mechanismObjective:To detect the effects of FLNa and UCP2 on proliferation,cell cycle arrest,apoptosis,migration and invasion of cancer cells.The effects of FLNa and UCP2 on Ras/MAPK/ERK signaling pathway and related molecules were detected.Methods:Build FLNa and UCP2 interference slow virus vector.FLNa and UCP2 were knocked down in CC cell lines to investigate the effects on cell proliferation,cell cycle arrest,apoptosis,migration and invasion.In addition,the present study investigated the expression of cell-associated proteins[extracellular signal-regulated kinase(ERK),phosphorylated(p)ERK,protein kinase B(AKT),p-AKT and B-cell lymphoma-2(Bcl-2)]and the mRNA levels of cellular proteins such as Ras,matrix metalloproteinase(MMP)-2 and MMP-9.To study the influence of related pathway molecules.Results:1.FLNa and UCP2 can significantly enhance the proliferation,migration and invasion ability of cervical cancer cells:FLNa or UCP2 knockdown slowed or decreased SiHa and HeLa cell proliferation,migration and invasion,with no significant change in apoptosis;2.Effects of FLNa and UCP2 on cell apoptosis and cell cycle:No obvious apoptosis was observed in cervical cancer HeLa and SiHa cell lines after the interference of FLNa and UCP2 genes.After interfering with UCP2 and FLNa genes,cell content of HeLa cell line decreased in G1 phase and increased in G2 phase.Cell content of SiHa cells increased in G2 phase after interfering with UCP2,while cell cycle of SiHa cells changed little after interfering with FLNa gene;3.FLNa and UCP2 can influence the protein content of Ras/MAPK/ERK signaling pathway and the transcription level of related genes:Western Blot results showed that after the interference of FLNa and UCP2 genes,the protein content of P-ERK and P-AKT1 in HeLa/SiHa cells decreased;PCR results showed that Ras,MMP2 and MMP9 gene transcripts were decreased after FLNa and UCP2 gene interference.No obvious apoptosis was observed after SiHa cells interfered with UCP2 gene.Conclusion:1.FLNa and UCP2 can affect cell proliferation,migration and invasion as well as cell cycle;2.FLNa and UCP2 may affect the occurrence and development of cervical cancer through Ras/MAPK/ERK signaling pathway.Part ?:Effects of FLNa and UCP2 on tumorigenicity of nude mice with cervical cancer cellsObjective:To investigate the effect of FLNa and UCP2 on tumorigenesis in nude mice with cervical cancer cells.Methods:siRNAs and restriction sites were designed according to the software,and the whole gene was synthesized and attached to the vector.FLNa>GGATCCCCGGGCTGGCAGCTACACCATTACTCGAGTAATGGTGTAGCTGC CAGCTTTTTTGAATTC UCP2>GGATCCCCGGGGTAAAGGTCCGATTCCAACTCGAGTTGGAATCGGACCTT TACCTTTTTTGAATTCLentivirus into packaging and steady turn plant set up in vitro nude mice tumor experiment results verify,nude mice tumor growth curve,IHC testing mice tumor FLNa,UCP2,P16 and Ki67 protein changes,different groups of tumor samples ERK,p-ERK,AKT1,p-AKT1,Bcl2 protein level changes,different groups tumor Ras,MMP2,MMP9 gene expression changes.Results:1.After interfering with FLNa and UCP2,tumor volume decreased significantly;2.After interfering with FLNa and UCP2,the protein content of ERK,P-ERK,AKT1,P-AKT1 and Bcl2 in tumor cells decreased,and the expression levels of Ras,MMP2 and MMP9 in tumor cells decreased.3.After interfering with FLNa and UCP2,the positive rates of UCP2,FLNa,P16 and Ki67 in tumor cells decreased.Conclusion:Animal experiments confirmed that FLNa and UCP2 may influence the development of cervical cancer through Ras/MAPK/ERK signaling pathway.