Font Size: a A A

Mechanism Research Of Simvastatin Inhibiting Adipogenic Differentiation Of Bone Mesenchymal Stem Cells

Posted on:2021-05-25Degree:DoctorType:Dissertation
Country:ChinaCandidate:Y GuoFull Text:PDF
GTID:1364330623475408Subject:Surgery
Abstract/Summary:
Osteoporosis is a systematic disease featured in decreased bone mass and increased bone microfracture,leading to reduced bone quality and increased risk of fracture compared to healthy individuals.Deterioration of bone results from bone resorption exceeds bone formation,which reflect in cellular level is the functional imbalance of osteoclasts and osteoblasts.Both the cells derive from two kinds of distinct stem cells,hematopoietic stem cells(HSCs)and bone mesenchymal stem cells(BMSCs),and the latter can also differentiate into chondrocytes,myocytes and adipocytes.Constant bone mass requires coordinate regulation of HSCs and BMSCs,and the subsequent osteoclast,osteoblast and adipocyte to maintain bone remodeling and homeostasis.The regulation of one type of cell may indirectly influence biofunctions of the other two types of cell,leading to the inhibition of bone remodeling.Clinically,anti-osteoporotic drugs mainly focused on inhibiting osteoclast or stimulating osteoblast,however,drugs targeting at the adipogenesis of BMSCs are still under development.Statin has been found to inhibit osteoclastogenesis,stimulate bone formation and inhibit adipogenesis for a long time.A most recent longitudinal cohort study confirmed statins,while not all of them,have potential protective effects on osteoporosis and even new-onset osteoporotic fractures.Normally,statins are used for lowering cholesterol to treat patients with hyperlipidemia and cardiovascular diseases due to their inhibition capacity on 3-hydroxy-3-methylglutaryl-coenzyme A reductases that catalyze mevalonate production.Simvastatin is liposoluble and had been widely studied for effectiveness in osteoporosis treatments,mainly due to its anabolic effects on bone by stimulating osteogenesis,inhibiting apoptosis of osteoblasts,and anti-osteoclastic effect by suppressing osteoclasts differentiation and activity.Moreover,the antiadipogenetic capacity of simvastatin further increase bone mass through multiple mechanisms.Currently,we have a wide knowledge of its mechanisms on osteoclast and osteoblast,but a shortage on adipocyte.Therefore,we still need to probe into the mechanisms in the process of simvastatin-mediated adipogenesis.Adipokine chemerin plays vital roles in adipogenesis of BMSCs.The biofunctions of chemerin rely on binding of three of its cognitive receptors:chemokine-like receptor 1(CMKLR1),G protein–coupled receptor 1(GPR1)and chemokine(C-C motif)receptor-like 2(CCRL2).In 2018,the first two receptors have been renamed as Chemerin Receptor 1 and Chemerin Receptor 2,respectively.In vivo studies showed correlations between chemerin signalling and osteoporosis,while in vitro evidences revealed its role deeply involved in adipogenesis of adipocyte precursor cells.Moreover,this signalling pathway has also been found to negatively regulate osteoblastogenesis of BMSCs and stimulate osteoclastogenesis of HSCs,further suggesting a regulation role of this signalling on bone homeostasis.CMKLR1 shares a high sequence and structural identity with GPR1 in the family of chemoattractant receptors and has been found to have similar roles with CMKLR1 in metabolic syndrome and cardiovascular disease.However,few researches have linked this receptor to bone metabolism.Due to evidences that the pathological processes mediated by chemerin/CMKLR1 signalling are highly in accordance with the metabolic diseases which affected by the statin-mediated inhibition of adipogenesis,we therefore speculate chemerin signalling may also play roles in the process of the statin-mediated inhibition of adipogenesis,and the receptor CMKLR1 is likely to mediate the signals of chemerin that affected by statin intervention.In this study,we detected the influence of simvastatin intervention on adipogenesis and expression of chemerin signalling,and then used RNA interference to explore the role of CMKLR1 in simvastatin-mediated adipogenesis.Moreover,a rescue experiment was performed by using PPARγagonist Rosiglitazone to further explore the mechanism of the inhibitory effect of Simvastatin on adipogenesis.Chapter One Identification of primary BMSCs in rats and screening for Simvastatin concentrationsObjective: Primary BMSCs of SD rat were isolation,passaged,purified and identified,and suitable Simvastatin concentrations were selected,providing a sufficient and reliable source of cells for subsequent BMSC-based drug studies.Methods: 1.Animals: ten female Sprague-Dawley(SD)rats of 4-week age and weight about 80 g were purchased from Vital River Laboratory.2.Extraction of rat primary BMSCs: syringe out the bone marrow in both sides of the tibia with a syringe.After centrifugation at 1200 r/min for 5 min,the supernatant was discarded,the cells were resuspended in BMSC basal medium,and inoculated in a culture flask for further culture.3.Passage and purification of rat BMSCs: rat primary BMSCs were exchanged was replaced for half volume at 48 hours after extraction,and then completely changed every 3 days.Passage the cultured cells at a ratio of 1:3-1:5 4.Flow cytometry to detect BMSCs surface molecular markers: BMSCs of passage 3 in concentration of 1×106/100μl were detected of CD44、CD90、CD11b、CD45 using flow cytometry.5.Adipogenic differentiation and identification of rat BMSCs: BMSCs of passage 3 were cultured in adipogenic medium A for 3 days and B for 1 day.Three to four cycles later,change the culture medium to the adipogenic medium B.The adipogenic differentiation ability of BMSCs was identified by oil red O staining after two to three weeks of differentiation.6.Osteogenic differentiation and identification of rat BMSCs: BMSCs of passage 3 were cultured in osteogenic medium for three to four weeks,and the osteogenic differentiation ability of BMSCs was identified by alizarin red staining.7.CCK-8 assay to detect the effect of different drug concentrations on proliferation of BMSCs: simvastatin at final concentration of 10-5M、10-6M、10-7M and 10-8M were added in 96-well plates.10 μl of CCK-8 solution was added to the wells at 1 d,2 d,3 d,4 d and 5 d after dosing.After incubation for 1 h,the absorbance at 450 nm was measured by a microplate reader.8.Statistical analysis: all experimental results are expressed as mean ± standard(mean ± SD)difference.In the screening of simvastatin concentration,one-way analysis of variance(ANOVA)was used to compare the differences between different groups.Data analysis was performed by SPSS 22.0.P < 0.05 was considered statistically significant.Results: 1.Morphological observation of BMSCs during passage: the extracted primary BMSCs were mixed cells of different sizes.After several fluid exchanges,the number of suspended cells and small round cells decreased gradually,while the number of filamentous cells increased gradually.The adherent cells grew radially and gradually became spindle-shaped,with multiple spiral growth centers.2.Identification of BMSCs surface antigen: the expression rates of CD90 and CD44 on BMSCs of passage 3 were 95.23% and 95.21% respectively,while the expression rates of CD45 and CD11 b were 1.15% and 0.27% respectively,which met the surface marker criteria for BMSC identification.3.Identification of adipogenic differentiation of BMSCs: during adipogenic differentiation,BMSCs gradually changed from fusiform to polygonal,and intracellular vesicular structures were observed,which contained clear yellowish liquid.Oil red O staining further indicated that the vesicle structure was lipid droplets.4.Identification of adipogenic differentiation of BMSCs: during adipogenic differentiation,BMSCs gradually changed from fusiform to polygonal,and the gradually increased sand-like deposits in the cells and irregular sand-like deposits between the cells were observed.Alizarin red staining further indicated that the sandlike deposition contented large amounts of calcium tissue.5.Effects of different concentrations of simvastatin on proliferation of BMSCs: within 5 d of incubation with different concentrations of simvastatin,the proliferation rate of the high-concentration statin(10-5M and 10-6M)intervention group was significantly reduced,while the low-concentration statin(10-8M)intervention group of which was slightly higher.The 10-7M simvastatin group had the least effect on BMSCs proliferation during the detection period.Conclusion: The BMSCs obtained from SD rats by adherent purification meets the standard and can be used for further mechanism study of the inhibitory effect of Simvastatin on adipogenesis.Chapter Two Correlation study of the inhibitory effect of Simvastatin on adipogenesis of BMSC and the expression of chemerin signallingObjective: To detect the expression of PPARγ and chemerin signaling in adipogenesis of BMSCs under the intervention of simvastatin,thus to explore their roles in the simvastatin-mediated inhibition of adipogenesis.Methods: 1.Cells: BMSCs of passage 3 were chosen for subsequent experiments.2.Screening of simvastatin intervention: the intracellular lipid droplets and the expression of adipocyte marker genes of different cell groups were detected at 14 days after adipogenic differentiation.Group SIM: add simvastatin at a final concentration of 10-7M throughout the adipogenic differentiation process.Group A: add simvastatin in first 3 days of adipogenic differentiation,and add an equal amount of PBS solution after.Group B: after 3 days of adipogenic differentiation,simvastatin was added,and PBS solution was added within 3 days.Group CON: add equal amount of PBS solution throughout the process of adipogenic differentiation.3.Experimental scheme of simvastatin intervention on gene expression: cell samples were collected on 3d,7d and 14 d of adipogenic differentiation to detect the gene expression of PPARγ,chemerin,CMKLR1 and GPR1 of BMSCs cultured with simvastatin of 10-7M or PBS.4.Western blot: cell samples were collected at 14 d of adipogenic differentiation,and the intracellular protein concentration was determined by BCA method.SDSPAGE electrophoresis was performed and followed by semi-dry membrane transfer.After incubation with milk powder,primary antibody incubation(adiponectin,1:1000;β-tubulin,1:1000)and secondary antibody,the PVDF membrane was subjected to color reaction,and the degree of exposure was analyzed by software.5.Detection of PPARγ,chemerin,CMKLR1,GPR1 and adiponectin expression by q RT-PCR: cell samples were collected at 3d,7d and 14 d for adipogenic differentiation,and the purified RNA concentration was measured by UV spectrophotometer.After reverse transcription reaction(37 ° C,15 min;85 ° C,5 sec),fluorescence quantitative reaction(95 ° C,5 sec;60 ° C,30 sec;40 cycles)was performed by two-step method,and m RNA expression was calculated by 2-ΔΔCT method.6.Statistical analysis: all experimental results are expressed as mean ± standard(mean ± SD)difference.In the screening of intervention program,one-way analysis of variance(ANOVA)was used to compare the differences between different groups.The effect of simvastatin on pathway gene expression was analyzed by paired t-test to analyze differences between groups.Data analysis was performed by SPSS 22.0.P < 0.05 was considered statistically significant.Results: 1.Effects of different simvastatin intervention regimens on the degree of adipogenic differentiation of BMSCs: BMSCs of the SIM group had the least intracellular lipid droplets,while which of CON group had the most lipid droplets.Group A and showed less lipid droplets than CON group but more lipid droplets than SIM group.Western blot showed of similar results with that of intracellular lipid droplets.Therefore,simvastatin inhibits lipid droplet formation during the whole process of adipogenic differentiation of BMSCs.2.Effect of simvastatin on the expression of PPARγ and chemerin during adipogenic differentiation of BMSCs: q RT-PCR showed that simvastatin intervention did not affect the increase in PPARγ and chemerin expression.The expression levels of PPARγ and chemerin between the two groups were not significant different at 3 d after differentiation,but the expression of CON group was significantly higher than the SIM group at 14 d.Thus,simvastatin inhibits PPARγ and chemerin expression during adipogenic differentiation of BMSCs.3.Effect of simvastatin on the expression of CMKLR1 and GPR1 during adipogenic differentiation of BMSC: q RT-PCR showed that simvastatin intervention did not affect the decrease in CMKLR1 and GPR1 expression.The expression levels of CMKLR1 and GPR1 between the two groups were not significant different at 3 d after differentiation,but the expression of CON group was significantly lower than the SIM group at 14 d.Thus,simvastatin stimulates CMKLR1 and GPR1 expression during adipogenic differentiation of BMSCs.4.Effect of simvastatin on the expression of adiponectin during adipogenic differentiation of BMSCs: q RT-PCR showed that simvastatin intervention did not affect the increase in adiponectin expression.The expression levels of adiponectin between the two groups were not significant different at 3 d and 7 d after differentiation,but the expression of CON group was significantly higher than the SIM group at 14 d.Thus,simvastatin inhibits adiponectin expression during adipogenic differentiation of BMSCs.Conclusion: PPARγ and chemerin signaling may mediate the inhibitory effect of Simvastatin on adipogenesis.Chapter Three Study of the role of CMKLR1 and PPARγ in simvastatin-mediated inhibition of adipogenesisObjective:To explore the role of CMKLR1 and PPARγ during the simvastatin-mediated inhibition of adipogenesis of BMSCs.Methods: 1.Cells and plasmids: 293 A and 293 T cells were purchased from cell bank of Chinese Academy of Sciences.Plasmids were purchased from Gene Pharma Company.BMSCs of passage 3 were chosen for subsequent experiments.2.Packaging,amplification and purification of adenovirus: shuttle plasmid containing target sequence of GCAATGGCCTGGTGATTGTCA was combined with backbone plasmid,DMEM and RNAi-Mate.After 6 hours of incubation,the cells were replaced with DMEM medium containing 10% FBS.14 d later,cells were collected and thawed repeatedly to obtain the original virus lysate solution,which was used to amplify the virus in 293 A cells.Cs Cl density gradient centrifugation and dialysis were used to purify the amplified virus solution.3.Determination of adenovirus titer: 293 T cell with concentration of 1×104/well were added up with viral solution,which was diluted by 102,103,104,105,106 and 107 times with DMEM medium containing 10% FBS in advance.Observation of cytopathic effect of each group under light microscope was performed 72 h later.The purified virus titer was calculated by a preset formula.4.Determining the best multiplicity of infection(MOI)and validation of viral infection efficiency: BMSC was inoculated into 96-well plate and divided into two groups according to whether 5 ug/ml coagulant amine was added or not,and gradient MOI subgroups of 1:10,1:100 and 1:1000 were set up respectively.After 72 h and 96 h,GFP fluorescence expression was observed under fluorescence microscope.Diluted virus solution with MOI of 100 was chosen,and q RT-PCR and western blot were performed to detect the expression of CMKLR1(NM008153).5.Experimental grouping of virus infecting BMSCs: simvastatin at final concentration of 10-7M or PBS was added in cell group of SIM or CON.In each group,BLANK,NC,and CKD were used to represent the PBS intervention,the virus-negative control intervention,and the experimental group after the CMKLR1 knockdown intervention.Viral infection was performed 48 h before adipogenic differentiation,and the expression of chemerin,CMKLR1,GPR1 and adiponectin was detected at 3 d and 14 d of adipogenic differentiation.6.Quantitative analysis of Oil red O staining: experimental grouping was in consistent with virus infection experiment,and Oil red O staining was performed as previously.Oil red O dye was further extracted from the adipogenic cells with 1 ml isopropanol before absorbance values at 490 nm were read.7.Rosiglitazone rescue experiment: groups of the control(CON),Rosiglitazone treatment(ROSI),Rosiglitazone and Simvastatin treatment(ROSI+SIM),and Simvastatin treatment(SIM)were set up.To test the role of PPARγ in our experiment,0.5 μM rosiglitazone was used as an agonist.8.Statistical analysis: all experimental results are expressed as mean ± standard(mean ± SD)difference.One-way analysis of variance(ANOVA)was used to compare differences between groups.Data analysis was performed by SPSS 22.0.P < 0.05 was considered statistically significant.Results: 1.Infectious efficiency of adenovirus under different MOI: after 96 h of virus infection,different degrees of GFP green fluorescence appeared in the virus-infected groups at all three MOI,but the fluorescence was most at 1:100.Therefore,MOI of 100 takes into account the influence of the number of infected cells and the toxicity of the virus;and has the best invasive effect.2.Fluorescence reexamination and validation of adenovirus infection efficiency: fluorescence detection showed that virus of group NC and CKD can successfully infect BMSCs.The results of q RT-PCR and western blot revealed the interference efficiency of adenovirus is about 20%-25% compared to normal level and can effectively reduce CMKLR1 expression.3.Effect of simvastatin on the expression of CMKLR1 with CMKLR1 knockdown: q RT-PCR showed that within CON and SIM group,CMKLR1 knockdown result in dramatically decreased CMKLR1 expression at both 3 d and 14 d,and simvastatin was unable to exert the effect of increasing CMKLR1 expression at 14 d.Thus,the decrease expression of CMKLR1 caused by adenovirus infection did not depend on the inhibitory effect of simvastatin on adipogenesis.4.Effect of simvastatin on the expression of adiponectin with CMKLR1 knockdown: q RT-PCR showed that within CON and SIM group,CMKLR1 knockdown result in dramatically decreased adiponectin expression at both 3 d and 14 d,indicating that BMSCs were not able to differentiate into mature adipocytes with CMKLR1 knockdown,and the inhibitory effect of CMKLR1 knockdown did not depend on whether simvastatin is used or not.Simvastatin decreased adiponectin expression at 14 d of adipogenic differentiation,but both group showed similar expression levels with CMKLR1 knockdown.Therefore,the inhibitory effect of simvastatin on adipogenesis of BMSCs depends on normal function of CMKLR1.5.Effect of simvastatin on the expression of GPR1 with CMKLR1 knockdown: q RT-PCR showed that within CON and SIM group,CMKLR1 knockdown result in dramatically decreased GPR1 expression at both 3 d and 14 d.The decreased expression of GPR1 with CMKLR1 knockdown indicates that GPR1 did not play a compensatory role.Meanwhile,simvastatin also failed to exert its effect of promoting GPR1 expression at 14 d.Thus,simvastatin could not affect adipogenic differentiation and the expression of chemerin signaling with CMKLR1 knockdown.6.Effect of simvastatin on Oil o staining with CMKLR1 knockdown: knock down of CMKLR1 greatly inhibited adipogenesis,as evidenced by reduced oil red O staining in CMKLR1 knock down cells,which is further confirmed by the quantitative analysis,suggesting that inhibition of chemerin-CMKLR1 signaling prevents the adipogenesis of BMSCs.Notably,simvastatin stimulation did not further decrease expression of adiponectin as well as the oil red O staining in CMKLR1 knock down cells,suggesting that the inhibitory effect of simvastatin on adipogenesis of BMSCs is dependent on chemerin-CMKLR1 signaling.7.Rosiglitazone rescue experiment: at day 3 and 14,rosiglitazone significantly increased expression of PPARγ and chemerin.Moreover,rosiglitazone also partially rescued the down-regulation of PPARγ and chemerin by simvastatin at day 3 and 14.The expression of CMKLR1 and the other receptor GPR1 were reduced by rosiglitazone treatment.We observed up-regulated adipogenesis in rosiglitazone-treated BMSCs following simvastatin stimulation,as evidenced by higher expression of adiponectin at 14 days compared to the control group.Taken together,these data suggest that simvastatin inhibits PPARγ-mediated chemerin signaling to prevent adipogenesis in BMSCs and that activation of PPARγ signaling by rosiglitazone is able to recues such an inhibitory effect.Conclusion: Down-regulation of PPARγ-chemerin-CMKLR1 signalling may be one of the mechanisms in the inhibitory effect of simvastatin on adipogenesis of BMSCs.
Keywords/Search Tags:BMSC, adipocyte, osteoclast, bone remodeling, simvastatin, adipogenesis, PPARγ, chemerin, CMKLR1
Related items