Font Size: a A A

SIRT4 Enhances The Sensitivity Of ER-positive Breast Cancer To Tamoxifen By Inhibiting The IL-6/STAT3 Signal Pathway

Posted on:2021-01-27Degree:DoctorType:Dissertation
Country:ChinaCandidate:J L XingFull Text:PDF
GTID:1364330611492082Subject:Pathology and pathophysiology
Abstract/Summary:
Objective:Breast cancer is one of the most common malignant tumors worldwide,which occurs in the mammary gland epithelial tissue.It is a serious threat to the health of women,and the majority of cases are estrogen receptor-positive.Owing to recent research and advances in endocrine therapy,the prospects for estrogen receptor(ER)-Positive breast cancer have improved.Tamoxifen is one of the most effective drugs for patients with ER-Positive breast cancer,but the development of resistance is common.Therefore,a better understanding of the molecular mechanism underlying tamoxifen resistance is of great significance to overcome this issue and further improve breast cancer treatment.Tamoxifen,a competitive estradiol antagonist,is the first-line endocrine therapy for estrogen receptor(ER)-Positive breast cancer.Tamoxifen kills breast cancer cells not only by binding to estrogen receptors in breast cells,but also by blocking glutamine uptake to reduce glutathione production.Sirtuin 4(SIRT4),a mitochondrial protein,is a member of the highly conserved Sirtuin protein family and has adenosine diphosphate(ADP)-ribonucleotransferase activity.By combining with glutamate dehydrogenase,SIRT4 can transform glutamate dehydrogenase by ADP-ribosylation,which prevents glutamate conversion intoα-ketoglutarate.Thus,the tricarboxylic acid cycle will be blocked.In this way,SIRT4inhibits the metabolism of glutamine.SIRT4 is a tumor suppressor gene in many cancers,such as lung cancer,colon cancer,gastric cancer and breast cancer,according to recent studies.However,few studies have examined SIRT4 in breast cancer.In view of the impact of SIRT4 on glutamine metabolism,we hypothesized that SIRT4 may affect the sensitivity of ER-Positive breast cancer to tamoxifen.The growth of cancer cells requires a constant supply of nutrients.Glutamine(Gln)is an essential nutrient for cell growth and viability.It is an important energy source and nitrogen source of cells and plays an important role in the occurrence and development of malignant tumors.Moreover,besides providing a material basis for the synthesis of biological macromolecules in cancer cells,glutamine can also participate in the regulation of multiple signal transduction pathways in cells.Researchers have confirmed that glutamine regulates cancer cell invasiveness via STAT3 activity and its deprivation significantly decreases the levels of STAT3 phosphorylation at tyrosine 705 in highly invasive ovarian cancer cells.In addition,glutamine deprivation essentially shut down translation of MYC and re-addition of glutamine restored translation in colon carcinoma cells.STAT3 mediates the expression of a variety of genes in response to cell stimuli and thus plays key roles in many cellular processes.Many cytokines,such as IL-6,can activate STAT3 signaling pathway through the corresponding tyrosine kinase-related receptors on the cell membrane.STAT3 hyperactivation via the phosphorylation of tyrosine 705 is common in most human cancers.In addition,an elevated level of STAT3phosphorylation at tyrosine 705 has been found in the tamoxifen-resistant cells MCF7/TAM.MYC and CCND1 are target genes of the STAT3 pathway.It has been reported that MYC is up-regulated in the tamoxifen-resistant breast cancer cell line MCF7/TAM,and cells are more sensitive to tamoxifen after knocking out the MYC gene.ER-Positive tumors with CCND1 amplification are not sensitive to tamoxifen.Although studies have shown that SIRT4 knockout reduces the sensitivity of colorectal cancer cells to 5-FU chemotherapy,whether SIRT4 affects the sensitivity of breast cancer to tamoxifen is uncertain,and the mechanism of SIRT4’s effect on drug sensitivity is unclear.Our study aims to explore the role of SIRT4 in the sensitivity of breast cancer to tamoxifen and its potential molecular biological mechanism,so as to provide a basis for future research on endocrine therapy resistance of breast cancer.Methods 1.The cell lines MCF7 and T47D were obtained from the Shanghai Cell Bank(Shanghai,China)and cultured according to the culture formula published on its officialwebsite.MCF7 cells were cultured in Dulbecco’s modified Eagle medium and T47Dcells were cultured in RPMI 1640 containing 10%fetal bovine serum(FBS).All cells were cultured in a sterile culture flask with a filter in a incubator of 5%CO2 at 37℃.The cells were passaged every 2 days with 0.25%trypsin.Afterwards,the cells were evenly laid in a 6-well cell culture plate.Lipofectamine 3000 was used to transfer SIRT4plasmids and SIRT4 interference sequences into cells,in order to up-regulate and down-regulate the expression of SIRT4 to provide preparation for subsequent experiments.Cells were used 48-72h after transfection.2.The levels of glutamine(Gln)in the medium were detected by Human glutamine ELISA Kit.After preparing Microelisa Stripplate,standard wells and testing samplewells were set.Add 50μl standard to each standard well.Add 10μl testing sample and40μl Sample Diluent to each testing sample well.Add 100μl Horseradishperoxidase(HRP)-conjugate reagent to each well,cover with an adhesive strip and incubate for 60 minutes at 37°C.Aspirate and wash the wells,repeating this process fourtimes.Invert the plate and blot it against clean paper towels.Add 50μl chromogen solution A and 50μl chromogen solution B to each well.Protecting from light,gently mix and incubate for 15 minutes at 37°C.Add 50μl Stop Solution to each well and read theOptical Density(O.D.)at 450 nm within 15 minutes.3.The cell suspension(100μL;50000 cells/m L)was inoculated in 96-well plates.Thecells were cultured in an incubator(37°C,5%CO2).After 12 h,the medium was replacedwith medium containing various concentrations of tamoxifen(1μM,2μM,2.5μM,5μM,10μM,20μM,40μM,80μM).The dishes were then cultured for an additional 48 h.Then,10μL of cell counting kit(CCK)-8 solution was added to each well.The dishes were placed in an incubator for 1 h.Absorbance at 450 nm was measured using a microplate reader.Excel and GraphPad 6.01 were used to calculate half maximal inhibitory concentration(IC50)values and to draw IC50 curves.4.Five groups of 96-well plates were prepared and inoculated with 100μL of the cell suspension(30000 cells/m L).The plates were cultured in an incubator(37°C,5%CO2).One group was removed every 24 h and supplemented with 10μL of CCK-8 solution ineach well.Then,the cells were incubated with CCK-8 solution for 1 h in the incubator.Absorbance at 450 nm was measured using a microplate reader.Cell proliferation curves were drawn using GraphPad 6.01.5.Cells were digested by 0.25%trypsin and collected in tubes.The suspension was then centrifuged at 1000 rpm for 10 min at 4°C.After removing the supernatant,1 mL of PBS was added to each tube.The cells were suspended and centrifuged again.This step wasrepeated twice.The cells in each tube were suspended in 500μL of Binding Buffer,and10μL of Annexin V-FITC and 10μL of PI were added sequentially.Samples were mixedin the absence of light.After 15 min,the apoptosis rate was detected by flow cytometry.6.Glass slides were placed in a 24-well plate.Then,250μL of the cell suspension with the appropriate concentration was evenly spread on the slides.Cells were fixed with 4%paraformaldehyde(in PBS)for 20 min and permeabilized with 0.5%Triton X-100(in PBS)for 10 min.Goat serum was added to the slides for 1 h at 25°C.Cells were incubated with mouse polyclonal anti-STAT3 and placed in a an incubator with high humidity at 4°C overnight.On the second day,the cells were incubated for 2 h at room temperature with Fluorescein(FITC)-Conjugated Goat-anti-mouse IgG.DAPI was used to stain nuclei and Antifade Mounting Medium was used to seal the slides.Then,images were obtained using a fluorescence microscope.7.Protein was extracted from the cell lysate and quantified by the Bradford method.Proteins with different molecular weights were separated by SDS-PAGE and transferred to a PVDF membrane.Membranes incubated with primary antibodies were placed at 4°C overnight.On the next day,after incubation with peroxidase-coupled anti-mouse or anti-rabbit IgG at 37°C for 2 h,the protein levels were visualized by Electrochemiluminescence(ECL).8.Cells in each well of a 6-well plate were collected using 1 mL of TRIzol.Total RNAwas extracted using 200μL of trichloromethane,followed by precipitation with 500μLof isopropanol and purification with alcohol.The PrimeScript RT Kit was used to reverse transcribe RNA to cDNA,and RNA levels were quantified by real-time quantitative PCR.The conditions were as follows:50°C for 2 min,95°C for 10 min and 95°C for 15 s for40 cycles,and 60°C for 1 min.The gene expression levels were determined by normalization against GAPDH mRNA expression.The primer sequences are as follow.SIRT4 Forward primer 5′–ACCCTGAGAAGGTCAAAGAGTTAC–3′;SIRT4 Reverse primer 5′–TTCCCCACAATCCAAGCAC–3′;MYC Forward primer 5′–TGAGGAGGAACAAGAAGATG–3′;MYC Reverse primer 5′–ATCCAGACTCTGACCTTTTG–3′;CCND1 Forward primer 5′–GCTGCGAAGTGGAAACCATC–3′;CCND1 Reverse primer 5′–CCTCCTTCTGCACACATTTGAA–3′;GAPDH Forward primer 5′–GGAGCGAGATCCCTCCAAAAT–3′;GAPDH Reverse primer 5′–GGCTGTTGTCATACTTCTCATGG–3′.9.SPSS 11.5 for Windows was used for all analyses.All data are presented as means±standard deviation.Differences between groups were evaluated by Student’s t-tests.P<0.05 was considered statistically significant.Results:1.Cells treated with tamoxifen and transfected with SIRT4 consumed less glutamine than those treated with tamoxifen only.2.Compared with cells treated with tamoxifen only,transfection with SIRT4 plasmids together resulted in decreased relative viability and proliferation,increased apoptosis,and reduced IC50 values for tamoxifen.Interference by SIRT4-siRNAs had the opposite effects.3.The expression of p-STAT3(Y705)was down-regulated after cells were transfected with SIRT4 plasmids but was up-regulated after cells were transfected with SIRT4-specific siRNAs.4.Relative to the negative control group,the expression of STAT3 in the nucleus was weaker in the group with SIRT4 up-regulation and stronger in the group with SIRT4down-regulation.5.IL-6 reversed the inhibition of STAT3 by SIRT4 and S3I-201 reversed the activation of STAT3 by SIRT4.6.The up-regulation of SIRT4 results in decreased transcriptional and translational activity of MYC and CCND1,while the down-regulation of SIRT4 results in increased transcriptional and translational activity of these genes.7.STAT3 offsets the effect of SIRT4 on the response of breast cancer cells to tamoxifen.8.SIRT4 overexpression resulted in significantly lower expression of IL-6 compared to control groups.Expression in the SIRT4-siRNA group was obviously higher.Conclusion:1.SIRT4 cooperates with tamoxifen to reduce glutamine uptake of ER-positive breast cancer cells.2.SIRT4 enhances the sensitivity of ER-Positive breast cancer cells to tamoxifen.3.SIRT4 inhibits the activation of the STAT3 pathway the expression of MYC and CCND1.4.SIRT4 affects the sensitivity of ER-Positive breast cancer cells to tamoxifen via the STAT3 pathway.5.SIRT4 inhibits STAT3 pathway activated by down-regulating IL-6.
Keywords/Search Tags:Breast Cancer, Glutamine, Tamoxifen, SIRT4, STAT3
Related items