Font Size: a A A

The Effect Of MEN1 Gene In Gastric Cancer And Its Possible Mechanisms

Posted on:2020-10-20Degree:DoctorType:Dissertation
Country:ChinaCandidate:K ZhaoFull Text:PDF
GTID:1364330602484378Subject:Gastrointestinal gland surgery
Abstract/Summary:PDF Full Text Request
Part I Correlation analysis between MEN1 and gastric cancerObjective:The expression of MEN]in normal gastric mucosal epithelial cells and gastric cancer cell lines,as well as gastric cancer tissues and adjacent normal tissues was detected,and the correlation between MEN1 expression and gastric cancer was analyzed.Methods:The clinical data of gastric cancer and the clinical data of the corresponding patients were collected,total RNA and total protein were extracted,and tissue paraffin sections were prepared.The expression of MEN1 mRNA in gastric cancer tissues and adjacent normal tissues was detected by RTQ-PCR.The expression level of MEN]encoding protein(Menin)was detected by Western blot and immunohistochemistry(IHC).The expression levels of MEN1 in gastric cancer tissues and adjacent normal tissues were compared,and the relationship between the expression of MEN1 and the clinicopathological features of gastric cancer was further analyzed.The immortalized gastric mucosal cells GES1 and gastric cancer cell lines AGS,MGC803,SGC7901,BGC823,HGC27 were collected,and total RNA and total protein were extracted.The expression of MEN]mRNA and protein in cells was detected by q-PCR and Western blot,and the correlation between the expression level of MEN1 and gastric cancer was analyzed.Results:1.Immunohistochemistry results showed that the expression of MEN1 was different in tissue cells.MEN1 was mainly distributed in the nucleus in the adjacent tissues(P<0.0001),while the cytoplasm was mainly distributed in the cancer tissues(P<0.0001).2.Q-PCR and WB results that in gastric cancer and adjacent tissues:the expression of MEN1 in adjacent tissues was higher than that in gastric cancer tissues(qPCR,P=0.0265;WB,P=0.035).3.The expression of MEN1 in cell lines qPCR and WB results:the expression of MEN1 in gastric cancer cell lines is lower than that in normal gastric mucosal epithelial cell lines,MEN1 has the highest expression in GES1(P<0.0001),while gastric cancer cell lines have low expression in different degrees.4.Relationships between MEN1 and clinicopathological features of gastric cancer:In the IHC results,the number of positive expression cases(IRS of cancer/IRS of para-cancer tissue>1)were 19 cases;the expression of MEN1 in gastric cancer tissues of lymph node metastasis group was lower than that without lymph node metastasis(P=0.0169);The expression of MEN1 in stage Ⅲ-Ⅳ was less than that in stage Ⅰ-Ⅱ(P=0.042);the low expression of MEN1 in tumor tissues was closely related to the late clinical pathological stage and lymph node metastasis of gastric cancer(P<0.05).There was no correlation with gender,age,degree of differentiation and tumor size(P>0.05).Conclusion:1.MEN1 is lowly expressed in gastric cancer tissues and highly expressed in adjacent tissues.2.MEN1 is lowly expressed relative to GES1 in gastric cancer cell lines AGS,SGC7901,MGC803,BGC823,and HGC27.2.The low exPression level of MEN1 is closely related to lymph node metastasis and advanced clinical pathological staging of gastric cancer.Part Ⅱ Construction of MEN1 gene silencing,overexpression vector and stable cell lineObjective:To Construction the MEN1 gene silencing and overexpression lentiviral vector and the corresponding stable cell lines.Methods:1.Design two siRNAs to be selected based on siRNA design principles;Synthesis of siRNA by chemical synthesis;The cells were transfected with siRNA using Lipofectamine 3000.After 48 hours,the silencing efficiency of MEN1 was detected by qPCR method,and the lentivirus vector plasmid was constructed by selecting the best.2.According to the selected target sequence,after synthesizing shRNA,the target fragment is ligated into the plasmid,and after transforming the competent cells,the monoclonal colonies are selected for sequencing,and after sequencing,the culture is expanded and the plasmid is prepared for use;the overexpression plasmid was purchased from Guangzhou GeneCopoea Co.Ltd.;3.The third generation of lentiviral packaging system(pMDLg/pRRE,pRSV-Rev,pMD2G),293T cells,Lipofectamine 3000 were used for lentiviral packaging,and then infected gastric cancer cells with the purified lentiviral particles,and constructed stable cell lines that silences and overexpresses the MEN1 gene by resistance gene screening method.Results:1.By qPCR verification,the inhibition rates of siRNA-1 CTG-TACCTGAAAGGATCATAC and siRNA-2 GCTGCGATTCTACGACGGCAT on MEN1 in AGS cell line were 83.13%and 80.59%,respectively(P<0.0001),and the inhibition rate of MEN1 in MGC803 cell line were 86.70%,82.30%respectively(P<0.0001),siRNA-1 has the best silencing effect.2.Successfully construct a recombinant lentiviral vector packaging plasmid.3.The overex-pression and silencing recombinant lentiviral vector was successfully packaged,and the titer of the lentiviral vector was:1.2E+8 TU/mL.4.Lentivirus was transfected into AGS and MGC803 gastric cancer cells,and the stable silencing and overexpressing MEN1 gene cell lines and corresponding negative control cell lines were successfully constructed.qPCR was used to detect AMS and MGC803 cells compared with control group and blank group.The efficiency was above 90%(P<0.0001).Compared with the control group and the blank group,the MEN1 overexpressed 14.8 and 15.6 times(P<0.0001),respectively.The results of WB verification showed that:AGS,MGC803 The expression folds were 2.03 and 1.85,respectively,and the expression of MEN 1 was decreased by 3 fold after silencing(P<0.001).Conclusion:The stable gastric cancer cell lines AGS-OE,AGS-KD,MGC803-OE and MGC803-KD with low expression and overexpression of MEN1 gene were successfully constructed,which laid a foundation for subsequent experiments.Part III The effect of MEN1 on the biological behavior of gastric cancerObjective:To detect the effects of overexpression and silencing of MEN1 gene on proliferation,apoptosis,invasion and migration of gastric cancer cells.Methods:On the basis of lentivirus transgenic plants,the proliferation of gastric cancer cells was detected by CCK8 and clone formation in vitro.The apoptosis rate of gastric cancer cells was detected by flow cytometry.The proliferation of gastric cancer cells was detected by scratch test.The transwell chamber was coated with Matrigel to detect the migration ability of gastric cancer cells.MGC803、MGC803/OE-MEN1、MGC803/SH-MEN1 were injected into the tail vein and footpad of the nude mice.The volume of the transplanted tumor was measured,and the lung metastasis was compared by HE staining.Results:1.After silencing the MEN1 gene,compared with the control group,the proliferation of gastric cancer cells was weakened,the apoptosis rate was no difference,and the migration and invasion ability was enhanced.After overexpression of MEN1 gene,the proliferation ability of gastric cancer cells was compared with the control group.There was no significant difference in apoptotic rate,and the migration and invasion ability decreased.Both AGS and MGC803 cell lines could repeat this result.In vivo experiment:After silencing MEN1 gene,the proliferation of plantar tumors in nude mice accelerated and promoted lung metastasis;overexpression of MEN1 gene could inhibit the proliferation of plantar tumors and lung metastasis(P<0.05).Conclusion:The effects of MEN1 gene intervention on proliferation,apoptosis and migration of gastric cancer cells were confirmed by in vitro experiments.It is presumed that MEN]plays a similar role as tumor suppressor gene in gastric cancer.Part IV Screening of differentially expressed genes in overexpressed and silenced gastric cancer cell lines by RNA-SequenceObjective:To investigate the downstream mechanism of MEN1 gene affecting the malignant phenotype of gastric cancer cells.Methods:Based on the stable transfectants constructed in the early stage,the total RNA of AGS,AGS-OE strain and AGS-KD strains was extracted and sent to the sequencing company for mRNA sequencing using Illumina HiSeqTM 2500 platform,followed by trend analysis method.The genes in the group screening showed the trend of differential expression,combined with bioinformatics methods,and were divided into positive and negative regulation,and then verified by qPCR.According to the results,the genes with the most trend and stable repeat were selected.Results:The sequencing was successful,and the candidate genes were positively regulated:HSPA6,PLOD2,ROS1;negative regulatory genes:ELF5,STAB1,KLK5,CTNNA3,LAG3,P2RY2,a total of 9;after screening and verification,the downstream regulatory group of MEN1 was initially determined.Because of HSPA6.Conclusion:This part successfully screened the regulatory molecules of MEN1 gene to be explored downstream.Part V Mechanism of silencing and overexpression of MEN1 gene on malignant phenotypic changes of gastric cancer cellsObjctive:To investigate the regulation mechanism of related signaling pathways affecting the malignant phenotypic changes of gastric cancer cells after MEN1 gene silencing and overexpression.Methods:Bioinformatics method,and search KEGG database,combined with literature review,select HSPA6,JNK/p-JNK,JunD/p-JunD,E-Cadherin,snail,vemintin,MMP2 molecules,at the protein level,Western blot The method detects its change.Results:After overexpression of MEN1 gene,HSPA6 expression increased,and there was no significant difference in JNK and JunD expression,while p-JNK and p-JunD were down-regulated,E-Cadherin was up-regulated,snail was down-regulated,vemintin was down-regulated,and MMP2 was down-regulated;MEN1 After gene silencing,HSPA6 was down-regulated,and there was no significant difference in JNK and JunD expression,while p-JNK and p-JunD were up-regulated,E-Cadherin was down-regulated,snail was up-regulated,vemintin was up-regulated,and MMP2 was up-regulated.Conclusion:After MEN1 intervention,the change of HSPA6 at the protein level is consistent with the transcription level;while JNK/JunD is mainly phosphorylated,we speculated that MEN1 may regulate the proliferation and invasion and metastasis of gastric cancer cells through HSPA6/JNK/JunD signaling axis.
Keywords/Search Tags:Gastric cancer, MEN1, HSPA6, JNK pathway
PDF Full Text Request
Related items