Font Size: a A A

The Study On The Collapse Mechanism In Steroid-induced Osteonecrosis Of Femoral Head Based On Microscopic Syndrome Differentiation Of Chinese Medicine

Posted on:2019-01-11Degree:DoctorType:Dissertation
Country:ChinaCandidate:P F LiFull Text:PDF
GTID:1364330548485164Subject:Fractures of TCM science
Abstract/Summary:
ObjectiveThis study intends to explore the mechanism of collapse by introducing the principle of modern biotechnology and computer biomechanics into the syndrome differentiation and treatment system of Steroid-induced Osteonecrosis of Femoral Head under the guidance of the theory of "microcosmic syndrome differentiation" of Chinese Medicine,in order to provide theoretical and experimental evidence of assessing the risk of collapse,further predict the prognosis of necrotic femoral head and seek the key points of anti-collapse,establish the corresponding micro-syndrome differentiation and treatment system of Osteonecrosis of Femoral Head,and finally guide the choice of clinical treatment options and improve the outcome of hip preserving surgery.This study was was composed by two parts: 1.Analyzing the differential expression of mi RNA in the normal area,non-collapse area and collapse area in patients with steroid-induced necrosis of the femoral head and predicting the target genes and possible pathways were used to investigate the biological mechanism of the collapse in Steroid-induced Osteonecrosis of Femoral Head.2.Creating the nine sections of the femoral head and establishing finite element model of the collapse of the Osteonecrosis of Femoral Head by finite element analysis based on fracture mechanics were used to explore the biomechanics mechanism of collapse in different micro femoral head.MethodsThe first part:1.Femoral heads of three patients(2 males and 1 female)treated by total hip arthroplasty(THA)for steroid-induced femoral head osteonecrosis wererandomly selected based on inclusion and exclusion criteria.Femoral heads were removed in surgery and a total of 9 bone tissue samples were obtained from each the collapse area(T),non-collapse area(W),and normal area(Z).2.Total RNA was extracted from tissue cells using Trizol Reagent and RNA sey Mini Kit was used for RNA purification.Nano Drop ND-1000 was employed for measurement of RNA concentration after purification and RNA integrity was detected by electrophoresis.After extraction,RNA samples underwent quality control and mi RNA was labeled using mi RCURYTM Array Power Labeling kit.After labeling,the sample was hybridized with mi RCURYTM LNA Array.3.Gene Pix Pro V6.0 was utilized to read the microarray scan images and the probe signals were selected.The median was taken and combined for the same probes.Probes >=30.0 for the samples were kept and the median was standardized in all microarray chips.Fold change more than 2.0 was used to screen mi RNA expression profiles between nine samples.mi RNAs showing differential expressions of fold change more than 1.5 between non-collapse area and collapse area were selected.4.The Real-time PCR reaction was performed for the hsa-mi R-195-5p in all samples and the internal reference gene(U6)separately.Data analysis was performed using 2-△△ CTmethod.5.Target Scan,mir Base and mi Randa bioinformatics software were used to perdict target genes for the most significant gene hsa-mi R-195-5p.GO analysis and Pathway analysis were done respectively for common target genes.The second part:1.A male healthy volunteer was recruited to collect the CT image data of hip joint according to inclusion criteria and exclusion criteria.The generated image file was saved in the DICOM format and copied to the computer workstation through the DVD.2.The data was imported into Mimics 15.1 software to establish the hip joint model through thresholding,regional growing,editing,three-dimensional calculating,smoothing and wrapping functions.Then,the geometric model was imported into Geomagic studio 2013 software to create a three-dimensional model of left hip joint with high biological simulation after deleting steps,filling holes,editing contour lines,constructing patches,constructing grille and fitting surfaces.3.The model of hip joint was imported into the Hypermesh 13.0 softwareand readjusted the assembly of the femur and acetabular to standing position referring to the position indicated by the x-ray of hip joint and standing limb force line.Then the entire model was meshed by using tetrahedral meshing method,and the grid size was 1.5-2.0 mm.4.Based on the three columns theory of the femoral head proposed by Li Zirong et al.,The anterior column,middle column and posterior column of the model in the sagittal plane were added to form the nine sections of the femoral head.Section 1 was the posterior-medial,Section 2 was posterior-middle,Section 3 was posterior-lateral,Section 4 was medial-middle,Section 5 was middle-middle,Section 6 was lateral-middle,Section 7 was anterior-medial,Section 8 was anterior-middle,Section 9 was anterior-lateral.5.The femoral head was divided into normal tissue and necrotic tissue in the model.Material properties were defined as elastic-plastic and isotropic materials.Section assignment was divided into two groups: The first group included a total of 10 tests that simulated femoral head force in condition of normal and necrosis of nine sections.The second group included a total of 30 kinds of tests that simulated the necrosis of medial column(sections147),middle column(coronal plane)(sections 258),lateral column(sections369)and anterior column(sections 123),middle column(sagittal plane)(sections 456),posterior column(sections 789)in 200 N,500N,700N(equivalent to body weight),1400N(2 times body weight),2100N(3 times body weight),respectively.Material failure setting was established using the keyword MAT_ADD_EROSION.Failure mode was according to strain failure that the material fails when the strain exceeds 2.4% of the material itself.6.Set as a quasi-static analysis to simulate one side of the hip joint standing position,the model of the acetabulum was completely fixed and the distal femur was loaded 200 N joint reaction force vertically.In order to avoid the embedding of the models,face-to-face contact is placed between the femoral head and the acetabulum.The middle part of the femur sets the motion constraint so that the femur can only move up and down along the Z axis.A k file was exported after model settings were finished.7.The k file was imported into the finite element analysis software LS-DYNA,and calculated in the set of NCPU 8 and MEMORY 200000000.The results of the analysis in form of d3 plot file were dynamically displayed in the Hyperview,and a suitable window was better selected for display of the comparison.Thefirst group of tests focused on changes of stress cloud in nine sections under normal femoral stress and single-area necrosis.The second group of tests mainly observed the time of failure collapse of the femoral head model under the six kinds of loads after that simulated the necrosis of medial column,middle column(coronal plane),lateral column and anterior column,middle column(sagittal plane),posterior column,and the extent of collapse of different necrotic models of force in similar time.ResultsThe first part:1.The results of quality control showed that the OD260 / 280 values of9 RNA samples ranged from 1.83 to 2.04,and the RNA integrity results showed that the bands of 28 S and 18 S ribosomal RNA were bright and clear by qualified and electropherogram,which indicated the 9 selected samples passed the quality control test.2.A total of 2085 differentially expressed mi RNAs were detected in the9 samples.Among the detected mi RNAs,433 mi RNAs showed more than 2.0-fold differential expression in the T1 group compared to the W1 group(among them,247 mi RNAs were up-regulated and 186 mi RNAs were down-regulated);344mi RNAs were differentially expressed by more than 2.0-fold in the T2 group compared to the W2 group(among them,225 mi RNAs were up-regulated and 119 mi RNAs were down-regulated);107 mi RNAs showed differential expression by more than 2.0-fold in the T3 group compared to the W3 group(among them,51 mi RNAs were up-regulated and 56 mi RNAs were down-regulated).Combining the data from all three patients,10 mi RNA were differentially expressed by more than1.5-fold in the collapse area(T1+T2+T3)compared to the un-collapse area(W1+W2+W3)(among them,8 mi RNAs were up-regulated: hsa-mi R-4472,hsa-mi R-4306.hsa-mi R-4747-5p,hsa-mi R-4441,hsa-mi R-4709-3p,ebv-mi R-BHRF1-2-3p,hsa-mi R-585-3p,and hsa-mi R-5572,while 2 mi RNAs were down-regulated:hsa-mi R-195-5p and hsa-mi R-645).Compared to the normal region,has-mi R-195-5p showed the most significant down-regulation.3.The following U6 primers were used for Real-time PCR:F: 5′GCTTCGGCAGCACATATACTAAAAT3′,R: 5′CGCTTCACGAATTTGCGTGTCAT3′.The primer sequences of hsa-mi R-195-5p were:GSP: 5′GGGGTAGCAGCACAGAAAT3′,R: 5′CAGTGCGTGTCGTGGAGT3′(GSP is a specific primer for mi RNA,while R is a primer that matches the RT primer).The Real-time PCR expression level of hsa-mi R-195-5p was significantly lower in the collapse area(T1+T2 +T3)than in the non-collapse area(W1+W2+W3)and normal area(Z1+Z2+Z3).4.157 genes were perdicted as the target gene of hsa-mi R-195-5p.GO analysis showed that the biological processes were mainly protein modification process,cell protein modification process and cellular protein metabolism process regulation,etc.The main cellular components were cytosol,nucleoplasm and intracellular organelles,etc.The main molecular functions were protein kinase activity,binding,phosphotransferase activity,alcohol group as acceptor,etc.Pathway analysis showed that the signaling pathways mainly included tumor pathways,p53 signaling pathway,m TOR pathway,insulin signaling pathway,tumor proteoglycans,breast cancer,pancreatic cancer,renal cell carcinoma,neurotrophin signaling pathway,Hippo signaling pathway,etc.The second part:1.The total hip joint model contained 281445 units and 51250 nodes after the meshing.The number of units in section 1 was 830,while the number of nodes was 277.the number of units in section 2 was 1945,while the number of units was 449.The number of units in section 3 was 1463,while the number of nodes was 277.The number of units in section 4 was 1322,while the number of nodes was 401.The number of units in section 5 was 1254 and the number of nodes was 347.The number of units in section 6 was 2393 and the number of nodes was 339.The number of units in section 7 was 744 and the number of nodes was236.The number of units in section 8 was 1842 and the number of nodes was 264.The number of units in section 9 was 1650 and the number of nodes was 162.In the first group,the stress and stress distributions in the normal section of the finite element model in this study were similar to the previous ones,which proved that the model had some validity.In the second test,the finite element model of collapse of femoral head through the theory of material failure based on fracture mechanics was established,which is closer to the actual concept of collapse.Furthermore,the dynamic process of the entire hip structure after necrosis of the femoral head was revealed by simulation of femoral head necrosis collapse model,which restored the dynamic process from early collapse,mid-term collapse and late hip dislocation,which was in line withthe development of clinical disease and further verify the finite element model.2.The total stress of the models in necrosis of 9 sections were 10.86 Mpa,8.74 Mpa,10.02 Mpa,10.40 Mpa,10.37 Mpa,11.53 Mpa,10.43 Mpa,9.57 Mpa and 11.52 Mpa,respectively.The maximum stress of necrosis in each area exceeded the hip joint stress of the normal femoral head,of which the maximum was 6 and 9,up to 11.5 Mpa.The stress of each subdivision in the 9 sections were as follows: the stress range of section 1 to section 9 was 0.45 Mpa ~11.58 Mpa at the necrosis of section 1.The stress range of section 1 to section9 stress was 0.47 Mpa ~ 11.78 Mpa at the necrosis of section 2.The stress range of section 1 to section 9 was 0.27 Mpa ~ 11.54 Mpa at necrosis of section3.The stress range of section 1 to section 9 was 0.42 Mpa ~ 11.48 Mpa at the necrosis of section 4.The stress range of section 1 to section 9 was 0.42 Mpa ~ 11.31 Mpa at the necrosis of section 5.The range of stress from section1 to section 9 was 0.4 Mpa ~ 11.53 Mpa at the necrosis of section 6.The stress range from section 1 to section 9 was 0.32 Mpa ~ 11.02 Mpa at the necrosis of section 7.The stress range of section 1 to section 9 was 0.43 Mpa ~ 12.39 Mpa at the necrosis of section 8.The stress range of section 1 to section9 was 0.42 Mpa ~ 11.6 Mpa at the necrosis of section 9.The stress of each subdivision in 9 sections showed that the maximum stress was in section 9,6 and 1,while the minimum stress was in section 3 and 7.3.No collapse criterion was found in the sections 789 and 258 after the200 N load was applied,and the maximum stress values were 16.82 Mpa and 14.92 Mpa respectively.The collapse criterion was reached in sections 123,456 and369 respectively,and only sections 369 appeared small pieces of collapse at10 ms.Only the sections 258 did not reach the collapse criterion after the load of 500 N was applied,and the maximum stress was 17.37 Mpa.Sections 456,789,123,147 and 369 all met the collapse criterion,and at the same time of 10 ms,there were serious collapses in sections 789 and 369.The sections258 did not meet the collapse criterion after applying a load of 700 N with a maximum stress of 17.63 Mpa.Sections 456,789,123,147 and 369 all met the collapse criterion,of which the collapse occurred in sections 369 at the time of 6 ms.At 10 ms,all the models except for sections 258 had almost completely collapsed.All the six models reached the collapse criterion after1400 N load was applied,of which the sections 369 began to collapse at 4.6ms.All models except for sections 258 had large collapse at 6.6 ms.All the six models reached the collapse criterion after 2100 N load was applied,of which 369 started to collapse at 3.8 ms.All the models except for sections258 had almost completely collapsed at 7.4 ms.Conclusion1.The study found that 10 kinds of differentially expressed mi RNAs in the collapse area of in patients with steroid-induced necrosis of femoral head,which may be biomarkers of steroid-induced osteonecrosis of the femoral head.Among them,the down-regulation of hsa-mi R-195-5p was most significant.The mechanism may be down-regulated by mi R-195-5p to destroy the proliferation of normal bone cells and to accelerate apoptosis and the adipogenic differentiation of BMSC,resulting in decreasing the structural strength of the femoral head which is unable to support the external force eventually lead to collapse.However,its specific target genes and pathways are not yet clear.2.This study simulated the finite element model of the collapse of the femoral head necrosis through finite element analysis of fracture failure based on the image data of healthy volunteers.On this basis,after the micro-states of different necrotic areas were set according to the nine-section method of the femoral head,the force and the collapse tendency of different necrotic areas were observed under the same material mechanical parameters and boundary conditions by finite element analysis respectively.The collapse tendency of different column of the necrosis were observed under the same material mechanical parameters and different boundary conditions by finite element analysis.With the increase of load,the time of necrotic femoral head begin to collapse was shortened and the degree of collapse of the femoral head was increased.At the same time,the higher the load,the greater the degree of collapse of the femoral head.When femoral head necrosis involved the lateral column(sections 369)and the anterior column(sections789),there was an increased risk of collapse and may collapse in a short period of time with severe collapse.In contrast,When femoral head necrosis involved the middle column(sections 258),the load required to reach the collapse failure criterion was large,the risk of collapse was reduced,the collapse occurred later,and the degree of collapse was not severe.Patients with necrosis of femoral head need to stand on both feet and to avoid standing on one foot.Patients who involving the necrosis of lateral column need to avoidweight-bearing activities and resolutely avoid running and bouncing strenuous activities.However,the mechanism of femoral head collapse in non-weight-bearing condition remains a problem to be solved.
Keywords/Search Tags:Microscopic Syndrome Differentiation, mi RNA, Steroid-induced Osteonecrosis of Femoral Head, Fracture mechanics, Finite Element Analysis, Collapse
Related items
Clinical And Finite Element Analyticalstudies On Survival With Collapsing Femoral Head In Patients With Non-traumatic Osteonecrosis Of The Femoral Head Under The Guidance Of The Holistic Concept
Clinical And Biomechanics Analysis Of Preventing Osteonecrosis Collapse Complicated With Femoral Neck Fracture Of Young Adult By Modified Surgical Treatment
Volumetric Measurement And Predicting The Collapse Of Osteonecrosis Of The Femoral Head Using Computerized MRI
The Clinical Study Of The Collapse Correspondent Mechanic Factors Of Steroid Osteonecrosis Of The Femoral Head And Related Strategy Of Treatment
The Role And Mechanism Of Dnmt1/H19/GSK-3β Axis Regulating Osteogenic And Adipogenic Differentiation Of BMSCs In Steroid-induced Osteonecrosis Of Femoral Head
The Study Of The Relation Of Blood Stasis Syndrome And Osteonecrosis Of Femoral Head,the Geometric Parameter Of Necrotic Area And Related Finite Element Analysis
Collapse Prediction Of Osteonecrosis Of The Frmoral Head Based On Proximal Sclerosis Proportions And Its Relationship With Traditionai Chinese Medicine Constitutions
Mechanical Evaluation And Collapse Prediction Of Onsteonecrosis Of The Femoral Head
Imaging And Biomechanical Study On The Collapse Risk Of Osteonecrosis Of Femoral Head Based On Association Of Activity And Inertia Theory
10 The Study Of Different Chinese Medical Syndrome Of Osteonecrosis Of Femora Head In Micro-Property In Trabeculars,Ultramorphorlogical Changes In Osteocytes And Related Finite Element Analysis