The Expression And Growth-Promoting Effect Of CDCA5 In Hepatocellular Carcinoma

Part ?:The relationship of CDCA5 expression with the clinical,pathological and prognosis in patients with hepatocellular carcinoma.Objective: Patients with hepatocellular carcinoma?HCC?has a dismal prognosis.Few studies have concentrated on the cell cycle of HCC.The expression of CDCA5 is increased in many cancer cells.In this part of the study,we aim to explore the relevance of CDCA5 with clinical and pathological characteristics,and to evaluate the prognostic role of CDCA5 in patients with HCC who underwent curative liver resection.Patients and Methods:1.Clinical pathological data: The clinical and pathological data were collected from HCC patients who underwent curative liver resection between September 2009 and September 2012,retrospectively.The collected data included clinical characteristics,pathologic details,surgical complications,recurrence-free survival?RFS?and overall survival?OS?.The expression of CDCA5 in tumors,para-cancerous tissues and normal liver tissues were detected by immunohistochemistry.The patients were classified into the CDCA5 over-expression group and the CDCA5 low-expression group.The prognoses between the two groups were compared.The risk factors of severe postoperative surgical complications?Clavien-Dindo classification grade ?-??were analyzed.We evaluated the prognostic function of CDCA5 and explored the risk factors of RFS and OS for those HCC patients who underwent curative liver resection.2.Immunohistochemistry: The CDCA5 monoclonal antibody was purchased from Abcam;The DAB concentrated kit and the goat anti-rabbit Ig G were purchased from Bioswamp.The methodology of the CDCA5 monoclonal antibody immune-histochemical staining was utilized according to the instructions.The main staining steps were as follows: paraffin section dewaxing hydration;3% H2O2 incubation to eliminate endogenous peroxidase activity;high pressure antigen recovery;normal goat serum incubation;primary antibody?CDCA5 monoclonal antibody?incubation at 4? overnight;3 times washing with PBS.Second antibody incubation?goat anti-rabbit Ig G antibody-HRP?;3 times washing with PBS.DAB chromogenic;light hematoxylin counterstain;alcohol dehydration;xylene transparent;neutral gland packing;microscopic observation.Results: A total of 178 patients were included in this study.The median of the semi-quantitative score of CDCA5 expression in HCC tissues was used as the cut-off point for over-expression and low-expression of CDCA5.89 patients were included in the CDCA5 over-expression group and 89 patients were included in the CDCA5 low-expression group.No statistically significant differences were found in age,gender,Child-Pugh score,ALT,ALB,TBIL,AFP,PLT,HBV-DNA and MELD score between the two groups.The tumor diameter was larger and the incidence of microvascular invasion was higher in the CDCA5 over-expression group than those of the CDCA5 low-expression group.The rate of surgical complication was 37.6%?67/178?.Postoperative complications included: bile leakage,postoperative intraperitoneal hemorrhage,liver failure,pleural/peritoneal effusion,respiratory failure,renal failure,abdominal abscess,deep venous thrombosis,acute pulmonary embolism,acute myocardial infarction,incision complications,et al.The rate of postoperative liver failure was 4.5%?8/178?.The 30-day mortality rate was 2.2%?4/178?.Totally 4 patients died within 30 days,including 1 acute myocardial infarction patient,1 pulmonary embolism patient and 2 grade C liver failure patients.16.9%?30/178?of the patients were combined with severe postoperative complications?Clavien-Dindo grade ?-??.There was no significant difference in the incidence of severe postoperative complications between the two groups.Univariate analysis indicated that tumor diameter and liver cirrhosis were risk factors for severe complications,while tumor diameter and major hepatectomy were risk factors for postoperative liver failure.Multivariate analysis suggested that tumor diameter was an independent risk factor for severe surgical complications and postoperative liver failure.In this study,the 1,3,5-year RFS rate were 77.0%,55.6% and 38.8%,and the 1,3,5-year OS rate were 89.3%,69.5% and 56.0%.In the CDCA5 over-expression group,the 1,3,5-year RFS rate were 69.7%,46.1% and 32.6%.The 1,3,5-year OS rate were 86.5%,61.5% and 47.8%.In the CDCA5 low-expression group,the 1,3,5-year RFS rate were 84.3%,64.0% and 44.9%.The 1,3,5-year OS rate were 89.9%,76.4% and 64.0%.Compared with patients in the CDCA5 low-expression group,the DFS and OS of the CDCA5 over-expression group were worse?P<0.05?.Univariate analysis suggested that CDCA5 over-expression,liver cirrhosis,tumor diameter,major hepatectomy and microvascular invasion were risk factors for DFS and OS.Cox regression analysis demonstrated that liver cirrhosis,tumor diameter and microvascular invasion were all independent risk factors for DFS,while tumor diameter and microvascular invasion were independent risk factors for OS.Conclusions: The patients who underwent curative liver resection with high expression of CDCA5 in HCC tissues had larger tumor diameter,higher incidence of microvascular invasion and poorer prognosis.Further studies are needed to explore the function of CDCA5 in HCC.Part ?:The mechanism of CDCA5 in promoting the growth of hepatocellular carcinoma cellsObjective: The over-expression of CDCA5 in HCC is correlated with worse outcomes.Further studies are needed to investigate the function of CDCA5 on the growth of HCC cells.In this part of the study,we aim to explore the function and mechanism of CDCA5 on the proliferation and apoptosis of HCC cells.Materials and methods:1.Materials: The lentivirus p Sico R,p CDH-CMV-MCS-EF1-Puro,the SMMC-7721,Hep G2 and Huh-7 HCC cell lines,DNA gel recovery and LATaq were purchased from Wuhan Hualian Branch Biotechnology Co.,Ltd.The endotoxin plasmid extraction kit was purchased from OMEG.T4 DNA ligase,endonuclease Xho I,Bam H I,Xba I were obtained from NEB;DMEM was obtained from Hyclone;Fetal bovine serum and streptomycin were purchased from Gibco Inc;PBS,0.25% trypsin and propidium iodide were obtained from Bioswamp;Lipofectamine 2000 were purchased from Invitrogen;Lentiviral Packaging Lentiviral Packaging Kit was obtained from Shanghai Yi Sheng Biological Technology Co.,Ltd;Ribonuclease A?RNase A?was obtained from Ta Ka Ra company;DH5? was preserved in our laboratory.2.Cell culture: The SMMC-7721,Hep G2 and Huh-7 cells were cultured in the DMEM medium,containing 10% fetal bovine serum and 1% penicillin.All the cells grown in a 5% CO2 incubator at 37°C.0.25% trypsin was used for digestion and subculture.Western blot was used to detect the expression of CDCA5 in the three cell lines.3.Experimental animals: SPF grade BAl B/C-nu/nu nude mice?4-6 weeks old,weighing 18-20g?were purchased from Beijing Huafukang Biotechnology Co.,Ltd.The animals were feed in the SPF animal room.4.Plasmid construction: Total RNA was extracted from human HCC tissues and reverse transcribed into c DNA.CDCA5 was amplified by the following primers?CDCA5-F: GCTCTAGATGTCTGGGAGGCGAACGC,CDCA5-R: CGGGATCCTCATTCAACCAGGAGATCA?using c DNA as a template.The target gene CDCA5 and the plasmid p CDH-CMV-MCS-EF1-Puro were double-digested with Xba I and Bam H I.The target gene CDCA5 was connected to the plasmid p CDH-CMV-MCS-EF1-Puro using T4 DNA ligase,and was then transformed into DH5? competent cells.Positive clones were expanded and subsequently used to extract plasmids from the endotoxin plasmid extraction kit.After sequencing,the correct CDCA5 overexpression plasmid was named as p CDH-CDCA5.According to the sequence of CDCA5?NM₀80668.3?in Gen Bank,three sh RNA interference target sequences?sh CDCA5-1,2,3?were designed by the sh RNA design program.Xho I and Bam H ? were used as restriction enzyme sites in the 5 '\ 3' end.Double-stranded DNAoligo containing the interfering sequences was synthesized according to the design principle.The p Sico R vector and the synthetic interference sequence were digested.The ligase ligated the interference fragment into the PSICOR vector by T4 DNA,and was then transformed into DH5? competent cells.The positive clones were selected and amplified.The plasmid was extracted with the endotoxin plasmid extraction kit.The correct CDCA5 interference plasmids were named as p Sico R-sh CDCA5-1,-2,-3.5.Transient transfection and identification: The Hep G2 cells were transfected with knockdown plasmids by Lipofectamine 2000-mediated gene transfection.The SMMC-7721 cells were transfected with overexpression plasmids.The efficiency of transfection was detected by quantitative real-time PCR and Western blot.6.MTT and colony formation assay: The Hep G2 cells with low-expression of CDCA5,the SMMC-7721 cells with over-expression of CDCA5 and negative control cells were collected in the logarithmic growth phase.After adjusting concentration,the cells were divided into 96-well plates,with 180?l each well.The density of the cells was 1-5×103 cells / well.Each of the three cells were inoculated with three wells as triplicates.100?L culture medium was used as a blank control.All the cells were then incubated at 37 °C overnight.The cells were transfected for 12 h,24h,48 h and 72 h by groups,respectively.20?l MTT solution?5mg/ml?was added to each well and incubated for another 4h.Then the supernatant was aspirated and discarded,150?l DMSO was added to each well,and the plates were placed on a shaker at low speed for 10 minutes to fully dissolve the crystals.The absorbance of each well was detected at 490 nm.The Hep G2 cells with low-expression of CDCA5,the SMMC-7721 cells with over-expression of CDCA5 and negative control cells of each group were examined by colony formation assay after a 14-days culture.7.Flow cytometry: The Hep G2 cells with low-expression of CDCA5,the SMMC-7721 cells with over-expression of CDCA5 and negative control cells of each group were digested with 0.25% pancreatic enzyme and transferred to flow cytometry tubes,followed by centrifugation at 1000r/min for 5 minutes.The supernatant was discarded,the pellet was suspended in 300 ?l PBS containing 10% fetal calf serum and transferred to a clean 1.5 ml centrifuge tube.700 ?l absolute ethanol was added and the cells were fixed in a refrigerator at-20 ° C for 24 h or more.Flow cytometry was used to detect the change of cell cycle.8.Tumorigenicity experiment in nude mice: The Hep G2 cells with low-expression of CDCA5 and the negative control cells were digested with 0.25% trypsin,and the cell number was counted.Cell concentration was adjusted to 1×107 cells/ml with serum-free medium.0.2ml cell solution was subcutaneously injected to each mouse using the Hep G2 cells with low-expression of CDCA5 and the negative control cells.We observed the viability of the nude mice and the growth of tumor.All the nude mice were sacrificed on the 30 th day,and the tumors were removed.The average weight of each tumor was calculated.9.Statistical AnalysisThe measured data with normal distribution were represented as?? ± S,while data with non-normal distribution were represented as median?full range?.The student t test was performed to compare the difference of normal distribution data between the two groups.One-way ANOVA was used to compare the difference among three groups.Mann-Whitney U test was performed to analyze the data with non-normal distribution.The ?2 test was utilized to compare the difference of count data between groups.We used SPSS 22.0 software for Windows?IBM version 22.0,NY,USA?for all the statistical analysis.All the statistical tests were 2-tailed,and P value <0.05 was considered statistically significant.Results:1.Plasmid construction and transfection: Western blot analysis showed that the expression of CDCA5 in Hep G2 cells was significantly higher than that of the SMMC-7721 and Huh-7 cells.Therefore,the Hep G2 cell line was selected for knock-down experiments.The expression of CDCA5 in SMMC-7721 was significantly lower than the other two HCC cell lines,thus the SMMC-7721 cell line was chosen for over-expression experiments.Western blot detected that the knockdown efficiency of the sh CDAC5-3 plasmid was the most obvious,so this plasmid was chosen for further experiments.Another over-expression plasmid was constructed for CDCA5 over-expression.After CDCA5 knock-down by the sh CDCA5-3 plasmid and over-expression by the p CDH-CDCA5 plasmid,results of western blot demonstrated that the relative expression of CDCA5 was 0.23 and 1.01,respectively.2.MTT assay: The proliferation rates were detected by MTT assay after CDCA5 knock-down in Hep G2 cells and CDCA5 over-expression in SMMC-7721 cells.12,24,48 and 72 hours after transfection with p Sico R-CDCA5-3,the inhibitory rates of Hep G2 cells in the knockdown group were?8.40 ± 2.07?%,?14.10 ± 0.53?%,?65.97 ± 0.58?% and?70.10 ± 1.04?%,respectively.With the prolongation of the transfection time,the proliferation rate of Hep G2 cells in the CDCA5 knock-down group was significantly inhibited.The survival rates of SMMC-7721 cells in the over-expression group were?102.83 ± 1.56?%,?116.23 ± 1.01?%,?128.93 ± 0.95?% and?130.03 ± 0.35?% at 12,24,48 and 72 hours,respectively.With the prolongation of the transfection time,the survival rate of SMMC-7721 cells in the CDCA5 over-expression group was significantly increased.3.Colony formation assay: After CDCA5 knockdown,the colony formation rate was?16.49±1.75?%,while it was?32.17±3.25?% in the negative control group.It was found that the quantity of formed clones in the CDCA5 low-expression group was less than that of the negative control group?P<0.05?.The proliferation ability of Hep G2 cells was attenuated after CDCA5 knock-down.After CDCA5 over-expression,the colony formation rate was?51.93±3.46?%,while it was?34.57±4.86?% in the negative control group.Results indicated that the quantity of formed clones in the CDCA5 over-expression group was more than that of the negative control group?P<0.05?.The proliferation ability of SMMC-7721 cells was increased after CDCA5 over-expression.4.Flow cytometry: Flow cytometry was used to detect the cell cycle of the Hep G2 cells with CDCA5 low-expression,the SMMC-7721 cells with CDCA5 over-expression group and the negative control cells.Compared with the negative control Hep G2 cells,G2 cells were significantly increased in the CDCA5 low-expression group.There was no significant difference of cell cycle between the CDCA5 over-expression group and the negative control group in SMMC-7721 Cells.The results suggested that the inhibition of Hep G2 cell growth was arrested in the G2 phase after CDCA5 knock-down.5.Tumorigenicity experiment in nude mice: Nude mice were subcutaneously injected with Hep G2 cells with CDCA5 low-expression and related negative control cells,respectively.On the average day 5,tumors were found subcutaneously in nude mice injected with negative control Hep G2 cells.On the average day 6,tumors were found subcutaneously in nude mice injected with CDCA5 low-expression Hep G2 cells.On the 30 th day after injection,the tumor weight of the negative control Hep G2 group and the CDCA5 low-expression group was 0.89 ± 0.07 gram and 0.66 ± 0.11 gram,respectively.The tumor weight of the negative control group was higher than that of the CDCA5 low-expression group,and the difference was statistically significant?P <0.05?.Immunohistochemistry showed that the expression of CDCA5 in the negative control group was higher than that of the CDCA5 low-expression group?P <0.05?.Conclusions: CDCA5 significantly promoted the proliferation of Hep G2 cells.We could modulate HCC by regulating CDCA5 in cancer cells.Further studies are needed to explore the signaling pathway of CDCA5 in HCC.Part ?The signal transduction mechanism of CDCA5 in promoting the growth of hepatocellular carcinoma cellsObjective: To further elucidate the role of CDCA5 in carcinogenesis,we focused on the proteins that might phosphorylate CDCA5 and the possible signaling pathways involved.CDCA5 was phosphorylated by ERK in lung cancer.The aim of this part was to investigate the transduction mechanism of CDCA5 in promoting the growth of hepatocellular carcinoma cells.Materials and methods:1.Materials: The Hep G2 cell line was purchased from Wuhan Hualian Branch Biotechnology Co.,Ltd.The U0126 inhibitor was purchased from Biovison company.The ERK1,ERK2 and CDCA5 rabbit anti-human antibodies were purchased from Abcam.The phospho-p44/42MAPK?e RK1/2??t HR202/t YR204?and GAPDH antibodies were purchased from Cell Signaling Technology.The goat anti-rabbit Ig G secondary antibody was purchased from Bioswamp company.2.Cell Culture: The Hep G2 cells were cultured in the DMEM medium containing 10% fetal bovine serum and 1% penicillin.All the cells were grown in a 5% CO 2 incubator at 37 °C,and were sub-cultured with 0.25% trypsin.3.The Hep G2 cells were stimulated by EGF with or without U0126: EGF is an activator of the MAPK signaling pathway,while U0126 is an inhibitor of MEK.In the experimental group,the Hep G2 cells were co-stimulated with 50 ng/m L EGF and 10 ?mol/L U0126 for 15,30 and 60 minutes,respectively.However,cells of the control group were independently stimulated with 50 ng/m L EGF for 15,30 and 60 minutes,respectively.4.The expression of ERK1,ERK2,p-ERK1/2 and CDCA5 were examined by western blot: The cells were collected by centrifugation,and protein lysis mixture was added to the cell suspension.The cells were lysed by centrifugation at 12000 g/min for 5 minutes at 4?,and proteins of the supernatant were quantified and stored at-80?.The expression of ERK1,ERK2,p-ERK1/2 and CDCA5 with stimulation for 15,30 and 60 minutes was detected by western blot,respectively.5.Statistical analysis: The Image J software was utilized to calculate the gray value of proteins measured by western blot.The ratio of the measured value of the target protein to GAPDH was considered as the relative expression of the protein.SPSS software for Window was used for all the statistical analysis.Results:1.The effect of EGF on the expression of ERK1,ERK2,p-ERK1/2 and CDCA5 in Hep G2 cells: The expression of p-ERK1/2 in Hep G2 cells was significantly increased after stimulation with EGF for 15 and 30 minutes.The expression of CDCA5 was increased with the time of EGF stimulation.At 60 minutes after EGF stimulation,the expression of p ERK1/2 was less than that of 15 and 30 minutes.There was no significantly difference in the changes of total ERK1 and ERK2 after EGF stimulation in Hep G2 cells.2.The effect of EGF and U0126 on the expression of ERK1,ERK2,p ERK1/2 and CDCA5 in Hep G2 cells: U0126 inhibited the expression of p ERK1/2 stimulated by EGF,and the expression of CDCA5 was decreased gradually with the decrease of p ERK1/2.There was no significantly difference in the changes of total ERK1 and ERK2 after EGF and U0126 co-stimulation in Hep G2 cells.Conclusions: CDCA5 changed with the changes of p ERK1/2,suggesting that CDCA5 might be involved in the MAPK signaling pathway and could be regulated by p ERK1/2.