Research Background:RA is a highly prevalent chronic inflammatory autoimmune disorder characterized by persistent synovitis,systemic inflammation and it often leads to other serious complications as well.It will finally lead to joint destruction,functional disability,and sometimes death.However,the pathogenesis of RA is poorly understood and there are no satisfactory therapeutic strategies to cure this disease.RNA interference(RNAi)is an evolutionarily conserved mechanism for silencing specific genes.The process of RNAi can be moderated by either microRNA(miRNA)or small interfering RNA(siRNA).Recently,alterations of miRNAs in RA have been reported in the past few years.Several aberrant expression of miRNAs have been found to contribute to various aspects of RA pathogenesis and may have applications in potential biotherapeutic approaches for RA diagnosis and treatment.For instance,miR-24,miR-26a,miR-125a-5p and miR-323-3p are found to be increased in RA,indicating that these miRNAs might be RA biomarkers.MiR-146a is significantly upregulated in RA and associate with TNF-a level and disease activity.MiR-19 can regulate TLR2 expression in rheumatoid fibroblast-like synoviocytes.Importantly,therapeutic trials aimed at targeting miRNA in arthritis have been conducted in vivo models.Thus,targeting miRNA will enable a new advanced therapy strategies for treating RA.miRNA and siRNA are processed inside the cell by the enzyme called Drosha,Dicer and a complex called RNA-induced silencing complex(RISC).The Argonaute family of proteins are essential components of RISC,which are involved in mRNA cleavage.Ago2 is the sole enzyme conferring this activity in mammals.Chen lan-fang investigate the expression and clinical significance of Dicer and Ago2 in peripheral blood cells of patients with SLE,and found that the expression of Dicer and Ago2 were significantly elevated in SLE patients and Dicer was positively correlated with SLEDAI and renal-SLEDAI.In a recent study show that Anti-Su autoantibodies from patients with RA and SLE recognize the Ago2 and Dicer proteins.However,components of the RNA interference machinery in RA remains largely unknown.Objective:Alterations of miRNAs in RA have been reported,but the regulation of these molecules is unclear.We investigated whether the levels of Dicer,Ago2 and Drosha mRNA,components of the RNAi,are associated with clinical signature in RA.Further study was undertaken to investigate the contribution of Dicer,which was identified in our pilot study,to the pathogenesis of RA.Methods:1.The first part of the experiment.The expression of Dicer,Ago2 and Drosha,components of the RNA-interference machinery in the peripheral blood mononuclear cells(PBMCs)of patients with RA.1.1 Subjects.We recruited 50 RA patients and 25 healthy controls after obtaining informed consent.The procedure was approved by the Medical Ethics Committee of the hospital.All RA patients fulfilled the American College of Rheumatology(ACR)classification criteria for RA.A RA Disease Activity Index(DAS28)score for each patient was determined at the time of blood draw.All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.1.2 Sample handling and RNA processing.Peripheral blood samples obtained from each subject were collected in tubes containing acid citrate dextrose formula A.Erythrocytes were immediately lyzed and total RNA was extracted from the leukocytes using Trizol(Invitrogen).Approximately 1ug of RNA was reverse transcribed into cDNA using SuperScript ? reverse transcriptase(Invitrogen)and oligo dT primers.1.3 Primers used were as follows:Dicer(forward 5' AGGAAGAGGCTGACTATGAAG,reverse 5' GGTT GAAAAAGGAG AAAGAGA);Ago2(forward 5'GTCTCTGAAGGCCAGTTCCA,reverse 5'ATACAGGCCTCACGGATGG);Drosha(forward 5' CAGCTACGAACGGAGCAGT,reverse 5' TTTTTCTTCCTCCCAACGAG);TNF-a(forward 5'CCCAGGGACCTCTCTCTAATCA,reverse 5'GCTACAGGCTTGTCACTCGG);RPL13a(forward 5' CCTGGAGGAGAAGAGGAAAGAGA,reverse 5'TTGAGGACCTCTGTGTATTTGTCAA).1.4 Real-time PCR.To determine the quantity of mRNA,the cDNA was amplified by real-time PCR with SYBR Green(SYBR Premix Ex TaqTM RT-PCR kit,Takara),and expression of RPL13a was determined as the internal control.SYBR Green assays were performed on a 7900HT real-time instrument(Applied Biosystems).Relative expression levels were calculated using the 2-AACt method.RT-PCR was performed at 95 ? for 15s,followed by 40 cycles at 95 ? for 5 s and 60? for 30s,and then performed at 95? for 15s,60? for 15s,95 ? for 15s.Results were analysed with SDS software version 2.3(Applied Biosystems).2.The second part of the experiment.Effects of Dicer on cytokines associated with rheumatoid arthritis.2.1 Cell culture.HeLa cells were maintained at 370C under an atmosphere of 5%CO2 in Dulbecco's modified Eagle's medium(DMEM)containing 10%FBS and 100 units/ml of penicillin/streptomycin.THP-1,MT2cells were maintained in RPMI 1640 medium containing 10%FBS and 100 units/ml of penicillin/streptomycin.Purified PBMCs were maintained 'in RPMI 1640 medium containing 10%serum of healthy control or Rheumatoid Arthritis and 100 units/ml of penicillin,and 100 units/ml of streptomycin at 37? in an atmosphere of 5%C02.2.2 Transfection and stimulation.The HeLa,THP-1and MT2 cells were transfected with 100 nM of Dicer siRNA or siRNA control.48 hours after transfection,the cells were stimulated with LPS(10 ug/ml,from E.coli strain K12,Invivogen)for 2 hours at 37? in an atmosphere of 5%C02.SiRNA control(sense 5'CAGUACUUUUGUGUAGUACAAdTdT3'',anti-sense5'TTGTACTACACAAAAGTACTG dTdT3');Dicer siRNA(sense 5' ACUGCUUGAAGCAGCUCUGGAdTdT3',anti-sense 5'UCCAGAGCUGCUUC AAGCAGUdTdT3');2.3 Enzyme-linked immunosorbent assay(ELISA).TNF-a,IL-10 and IL-6 protein secreted into the cell culture supernatant was quantified using commercially available ELISA kits(Xi Tang Biology)according to the manufacturer's protocol.2.4 Isolation of PBMCs.All healthy samples were obtained from healthy volunteer donors.Peripheral blood mononuclear cells(PBMCs)were separated from heparinized whole blood by density-gradient centrifugation on Lymphoprep Ficoll-Paque Plus(GE Healthcare).2.5 Sample handling and RNA processing.Peripheral blood mononuclear cells were immediately lyzed and total RNA was extracted from the PBMCs using Trizol(Invitrogen).Approximately lug of RNA was reverse transcribed into cDNA using SuperScript ? reverse transcriptase(Invitrogen)and oligo dT primers.2.6 Primers used were as follows:Dicer(forward 5' AGGAAGAGGCTGACTATGAAG,reverse 5' GGTTGAAAAAGGAGAAAGAGA);TNF-a(forward 5'CCCAGGGACCTCTCTCTAATCA,reverse 5' GCTACAGGCTTGTCACTCGG);IL-10(forward 5'-AAAAGAAGGCATGCACAGCTCAG-3,,reverse 5'-GTGGGTGCAGCTGTTCTCAGACT-3');RPL13a(forward 5' CCTGGAGGAG AAGAGG AAAGAGA,reverse 5'TTGAGGACCTCTGTGTATTTGTCAA).2.7 Real-time PCR.To determine the quantity of mRNA,the cDNA was amplified by real-time PCR with SYBR Green(SYBR Premix Ex TaqTM RT-PCR kit,Takara),and expression of RPL13a was determined as the internal control.SYBR Green assays were performed on a 7900HT real-time instrument(Applied Biosystems).Relative expression levels were calculated using the 2-??Ct method.RT-PCR was performed at 95? for 15s,followed by 40 cycles at 95? for 5 s and 60? for 30s,and then performed at 95 ? for 15s,60 ? for 15s,95 ? for 15 s.Results were analysed with SDS software version 2.3(Applied Biosystems).3.The third part of the experiment.TNF-a expression could be regulated by manipulation of Let-7/miR-98.3.1 Constructs and Reporter gene assay.To create 3' UTR luciferase reporter constructs,fragments of 3' UTR of Dicer gene harboring the predicted let-7/miR-98 binding sites were cloned downstream of the firefly luciferase cassette in psiCHECKTM-2 vector.Primers used were as follows:Dicer(forward 5' CCG CTC GAG GCT CAT TAT TTC CAT CTT T 3'reverse 5' TAG CGG CCG CAC CAC ATT TTT TTC CTC TC 3');Hela cells were seeded in the wells of a 24-well plate and then transfected with a mix of 100 ng of 3'-UTR luciferase reporter vector and 100nM of miR-98 mimic and inhibitor.24 hours after transfection,cells were lysed and luciferase activity was measured on a luminometer(CENTRO XS3 LB 960)by using the Dual-Luciferase Reporter assay system.The ratio of firefly luciferase to Renilla luciferase was obtained for each well.3.2 Transfection and stimulation.The HeLa cells were plated in culture dishes for 24 h and then transfected with 100 nM of miR-98 mimic and inhibitor with lipofectamine 2000(Invitrogen)according to the manufacturer's protocol.3.3 Sample handling and RNA processing.Hela cells were collected in tubes and total RNA was extracted from Hela cells using Trizol(Invitrogen).Approximately lug of RNA was reverse transcribed into cDNA using SuperScript ? reverse transcriptase(Invitrogen)and oligo dT primers.3.4 Real-time PCR.To determine the quantity of mRNA,the cDNA was amplified by real-time PCR with SYBR Green(SYBR Premix Ex TaqTM RT-PCR kit,Takara),and expression of RPL13a was determined as the internal control.SYBR Green assays were performed on a 7900HT real-time instrument(Applied Biosystems).Relative expression levels were calculated using the 2-??Ct method.RT-PCR was performed at 95 ? for 15s,followed by 40 cycles at 95 ? for 5 s and 60? for 30s,and then performed at 95 ? for 15s,60? for 15s,95 ? for 15s.Results were analysed with SDS software version 2.3(Applied Biosystems).3.5 Western blot were performed to identify miR-98 target Dicer.HeLa cells were seeded in a six-well plate and transfected with 100nM of miR-98 mimic and inhibitor per well.Twenty-four hours after transfection,cells were lysed and proteins were extracted.Supernatants were then subjected to SDS-PAGE,blotted with the indicated antibodies,and detected by Luminol/Enhancer Solution(Pierce).Dicer and ?-actin antibodies were obtained from Abcam and Chemicon.HRP-conjugated secondary antibodies were obtained from Santa Cruz.Relative expression levels were quantified using Quantity One software,version 4.52(Bio-Rad).3.6 Enzyme-linked immunosorbent assay(ELISA).48 hours after transfection,HeLa cells were stimulated with LPS(10 ug/ml,from E.coli strain K12,Invivogen)for 2 hours at 37?in an atmosphere of 5%C02.TNF-? protein secreted into the cell culture supernatant was quantified using ELISA kits(Xi Tang Biology)according to the manufacturer's protocol.Statistical analysis Data were analyzed using Prism 4 software,version 5.01(GraphPad).The nonparametric Mann-Whitney test was used to draw comparisons between groups.The Spearman test was used for correlation studies.Two-tailed P values less than 0.05 were considered statistically significant.Results:1.The results of the first experimental partThe expression of Dicer and Drosha mRNA were upregulated in RA groups comprared to healthy controls(p<0.0001,p=0.0235),while the Ago2 mRNA expression was no difference in RA patients compared with healthy controls.In high activity RA group,the expression of Dicer and Drosha mRNA was upregulated compared to the low activity RA group(p=0.0107,p=0.0246).Furthermore,the Dicer mRNA expression levels correlated with CRP levels(r=0.4813,p=0.0004),ESR(r=0.4028,p=0.0037)and DAS28 scores(r=0.4893,p=0.003).2.The results of the second experimental partTransfection of Dicer siRNA increased TNF-a expression and decreased IL-10 expression.TNF-a and Dicer mRNA levels were both enhanced with the peak level at 4h after LPS treatment.Interestingly,this process can be mimicked by supplemented with 10%serum of Rheumatoid Arthritis.3.The results of the third experimental partDicer expression could be regulated by let-7/miR-98 family.MiR-98 mimic which downregulate Dicer expression could increase TNF-a protein expression levels,whereas miR-98 inhibitor which upregulate Dicer expression decreased TNF-a expression.Conclusion:We found that Dicer and Drosha mRNA expression were dramatically upregulated in Rheumatoid Arthritis and that the increased level of Dicer was correlated with disease activity in patients with RA.Dicer can be used as a marker of Rheumatoid Arthritis diagnosis and disease activity.The activation of Dicer can suppress TNF-a production and promote IL-10 production,avoiding the systemic effects mediated by cytokine in RA.The outcome of these regulatory mechanisms was the balanced production of cytokine,which was critical for physiological immune and inflammatory responses.At the same time,we found that let-7/miR-98 family can indirectly regulate TNF-? expression,which was important for the development of new small molecule of TNF-?-targeted therapeutic. |