Font Size: a A A

The Role Of CXCR4 Nuclear Location In The Metastasis Of Renal Cell Carcinoma

Posted on:2016-04-02Degree:DoctorType:Dissertation
Country:ChinaCandidate:Z X WangFull Text:PDF
GTID:1364330461465892Subject:Surgery
Abstract/Summary:
Renal cell carcinoma is one of the three most common urinary malignant diseases, whose incidence and cancer related mortality of renal cell carcinoma are still in the top 10 highest incidence in male urinary malignant disease all over the world. Each year, it is reported that about 61,500 new cases are diagnosed as renal cell carcinoma in United States. Compared with the other cancers, the prognosis of renal cell carcinoma would be poorer when metastasis. However about one third patients with renal cell carcinoma are diagnosed as metastasis when diagnosed at the first time, and twenty to forty percent patients would eventually developed into cancer metastasis. As such, it is very important to study the mechanisms of renal cell carcinoma metastasis. It would be important to study the biological characteristics and special genes of renal cell carcinoma and improve therapeutic method and overall survival.Objective: 1) To study the relationship of nuclear CXCR4 expression and renal cell carcinoma metastasis, and discuss its influence on prognosis of renal cell carcinoma. 2) To study the role of CXCL12 during nuclear location of CXCR4. 3) To explore the mechanism of HIF-1 alpha(hypoxia induced factor 1 alpha) promote nuclear location of CXCR4 and the relationship of subcellular localization of HIF-1 alpha and renal cell carcinoma metastasis. 4) To study the mechanism of HIF-1 alpha and CXCR4 promote metastasis through activation of proteins involved in the epithelial-mesenchymal transition(EMT) process in metastasis of renal cell carcinoma.Methods: 1) The expression of CXCR4 in renal cancer cells before and after CXCL12 stimulation and tissue were studied by real-time quantitative RT-PCR, NE-PER? nuclear and cytoplasmic extraction reagents, immunofluorescence, immunohistochemistry. 2) The samesense mutation(709-726) and nuclear location(436-447) sequence mutation of CXCR4 was constructed by PCR, and p Lenti-CMV-EGFP-3FLAG-IRES-Puro viral vector was used to constructed lentivirus with EGFP-CXCR4(samesense mutation) and NLS-CXCR4(samesense mutation and nuclear location sequence mutation). A lentivirus with CXCR4 specific sh RNA which matches the samesense mutation(709-726) was constructed. The lentivirus with EGFP-CXCR4, NLS-CXCR4 or sh RNA CXCR4 was confirmed by fluorescence microscope, real-time PCR and western blot. 3) The biological charateristics of lentivirus with EGFP-CXCR4 or NLS-CXCR4 were studied by CCK8 assay, invasion chamber, clone formation efficiency, flow cytometry and xenograft in nude mice. 4) The information and specimens of 98 RCC patients in Changhai Hosppital from 2007 to 2008 were collected. And tissue microarray was used to explore the expression of CXCR4, the relationship of CXCR4 nuclear location and prognosis of these patients. 5) Two plasmids including p EGFP-CXCR4 and p Ds Red2-CXCL12 were constructed to study the role of CXCL12 in CXCR4 nuclear location. And the expression of CXCL12 in RCC cells and RCC tissue was detected by immunofluorescence and immunohistochemistry. 6) The interaction of HIF-1 alpha and CXCR4 in RCC cells during CXCR4 nuclear location was studied by co-immunoprecipitation, western blot, immunofluorescence and immunohistochemistry. 7) The influence of HIF-1 alpha inhibitor, HIF-1 sh RNA and hypoxia on the expression of HIF-1 alpha and CXCR4 were evaluated by co-immunoprecipitation, western blot. 8) The relationship of HIF-1 alpha on cancer development, invasion and metastasis of RCC was studied by the tissue microarray. 9) And the correlation of CXCR4 nuclear location and EMT-related genes, such as Vimentin, E-cadherin, CD44, NF-kappa B were explored by western blot and immunohistochemistry. 10) The influence of CXCR4 nuclear location on EMT-related genes, such as Vimentin, E-cadherin, CD44, NF-kappa B was detected by stable transfected cell lines with EGFP-CXCR4 and NLS-CXCR4. 11) The mechanism of HIF-1 alpha and CXCR4 nuclear location related EMT in RCC cells was studied by western blot and NE-PER? nuclear and cytoplasmic extraction reagents.Results:1). The results of western blot showed nuclear expression of CXCR4 increased after CXCL12 stimulation for 24 hours. CXCR4 nuclear location was found in primary RCC tissue, but not all. And nuclear expression of CXCR4 was found in all metastatic RCC tissue.2). The samesense mutation(709- GCCCTCAAGACCACAGTC-726 to 709-GCTCTGAAAACAACCGTG-726) and nuclear location(436-AGGCCAAGGAAG-447 to 436-GCCGCTGCCGCT-447) sequence mutation of CXCR4 was constructed by PCR, and p Lenti-CMV-EGFP-3FLAG-IRES-Puro viral vector was used to constructed lentivirus with EGFP-CXCR4(samesense mutation) and NLS-CXCR4(samesense mutation and nuclear location sequence mutation). DAN sequencing was used to confirm the correct sequences of the lentivirus. A lentivirus with CXCR4 specific sh RNA(sequence: CCGGCCCTCAAGACCACAGTCATTTCAAGAGAATGACTGTGGTCTTGAGGGTTT TTTG) which matches the samesense mutation(709-726) was constructed. The lentivirus was transfected to ACHN cells. The m RNA and protein of CXCR4 in stable transfected cell lines with EGFP-CXCR4, NLS-CXCR4 and sh RNA-CXCR4 was detected by real-time PCR and western blot, respectively. The protein EGFP-CXCR4 was found in cytoplasm and nucleus, and the NLS-CXCR4 was found only in cytoplasm but not nucleus. The western blot results showed CXCR4 was knocked down in Sh RNA-CXCR4 cell lines.3). The results of cell proliferation assay with CCK8 showed there was significant difference between EGFP-CXCR4 group and EGFP group from the third day(p<0.05) and significant differences between NLS-CXCR4 group and EGFP group from the fourth day. It was significant differences between EGFP-CXCR4 group and NLS-CXCR4 group(p<0.05), EGFP-CXCR4 group and EGFP group in invasion chamber experiments(p<0.05), but no significant differences between NLS-CXCR4 group and EGFP group or ACHN control group(p>0.05). The EGFP-CXCR4 group got the highest score, then NLS-CXCR4 group got the second highest score which showed significant differences versus EGFP group in the results of clone formation efficiency(p<0.05). The apoptosis experiment with flow cytometry showed the apoptosis rate for EGFP, EGFP-CXCR4 and NLS-CXCR4 was. 14.8%, 5.33% and 5,28% respectively. Stable transfected RCC cell lines with EGFP-CXCR4, NLS-CXCR4 and EGFP were transplanted to nude mice. From the 16 th day after transplantation, the xenograft in nude mice showed significant volume differences between EGFP-CXCR4 group and EGFP group(p<0.05).4). The expression of CXCR4 was higher than the surrounding normal tissues in renal cell carcinoma and the CXCR4 nuclear expression occurs in 64.7% primary renal cell carcinoma sites. The CXCR4 nuclear location group showed poorer prognosis than the non-CXCR4 nuclear location group in the results of follow up. And the CXCR4 nuclear expression showed no correlation with symptoms scores, AJCC stages, proliferation rates, recurrence, metastasis of renal cell carcinoma, ages, genders, locations of tumors and Fuhrman scores(p>0.05).5). The plasmids of p EGFP-CXCR4 and p Ds Red2-CXCL12 were constructed and confirmed by DNA sequencing. The green and red fluorescence were found in 293 cells transfected by plasmids of p EGFP-CXCR4 and p Ds Red2-CXCL12. And yellow fluorescence was found in the cytoplasm of 293 cells. CXCL12 and CXCR4 expressed in cytoplasm, and only CXCR4 could be found in nucleus after CXCL12 stimulation in immunofluorescence experiments. And the results of immunohistochemistry experiments showed no CXCL12 expressed in nucleus in the renal cell carcinoma tissue with CXCR4 nuclear location.6). The HIF-1 alpha nuclear expression showed correlation with CXCR4 nuclear expression in primary renal cell carcinoma tissue. And the HIF-1 alpha showed nuclear location after CXCL12 stimulation. The protein HIF-1 alpha was found in the results of co-immunoprecipitation with EGFP-CXCR4 group and NLS-CXCR4 group, but was not found in EGFP group.7). The expression of HIF-1 alpha and CXCR4 decreased in nucleoprotein after stimulated by HIF-1 alpha inhibitor. And expression of HIF-1 alpha in RCC cells increased after cultivated in hypoxia.8). The HIF-1 alpha nuclear location group showed poorer prognosis than the nonHIF-1 alpha nuclear location group in the results of follow up. And the HIF-1 alpha expression showed correlation with proliferation rates, pathological results and tumor size(p<0.05). However there was no significant correlation between HIF-1 alpha nuclear expression and ages, genders, locations of tumors, symptoms scores, AJCC stages and Fuhrman score s(p>0.05). The results of tissue microarray showed HIF-1 alpha nuclear expression was correlation with CXCR4 nuclear expression in primary renal cell carcinoma tissue(p<0.05).9). Low expression of Vimentin, caspase-3 and high expression of E-cadherin, CD44, NF-kappa B, PCNA, Ki-67, CD105 were found in primary renal cell carcinoma tissue with CXCR4 nuclear location. And in the renal cell carcinoma tissue without CXCR4 nuclear location, the adverse results was found. The protein E-cadherin, CD44 and NF-kappa B expressed higher in western blot with ACHN cells after cultured in hypoxia. And the expression of E-cadherin increased after CXCL12 stimulation which could be inhibited by AMD3100. After stimulated by CXCL12 or cultrued in hypoxia could impoved the ivasion ability of RCC cells, which could be inhibited by HIF-1 alpha inhibitor and AMD3100.Conclusion: 1) CXCL12 promotes the expression of CXCR4 in nucleus of RCC cells. CXCR4 nuclear location was found in partial primary RCC tissue. CXCR4 nuclear expression was correlation with symptoms scores, AJCC stages, proliferation rates, poor prognosis of renal cell carcinoma. The nuclear location sequence of CXCR4 in RCC is 146-RPRK-149. After stimulated by CXCL12, CXCR4 could not located in nucleus with mutation of NLS. The expression of CXCR4 could promote proliferation, invasion, clone formation efficiency of renal cancer cells. CXCL12 could interacts with CXCR4 in the cytoplasm, but not in the nucleus. 3). HIF-1 alpha interacts with CXCR4 during CXCR4 nuclear location. HIF-1 alpha was found expressed in nucleus in partial primary RCC tissues, and was correlation with symptoms scores, AJCC stages, proliferation rates, poor prognosis of renal cell carcinoma. 4) HIF-1 alpha interacts with CXCR4 which was the key mechanism of hypoxia promotes CXCR4 nuclear location. 5) After stimulated by CXCL12, CXCR4 interacts with HIF-1 alpha and together expressed in nucleus, which promotes metastasis of RCC by EMT.
Keywords/Search Tags:CXCL12/CXCR4 bio-axis, Renal cell carcinoma, HIF-1 alpha, CXCR4 nuclear expression, EMT
Related items