| BackgroundAcute coronary syndrome is a major cause of death in China.The research shows that the stability of acute coronary syndrome in acute myocardial infarction depends on atherosclerotic plaque,rather than the extent of coronary artery stenosis.More than 68.5% of the myocardial infarction were due to the vulnerable plaque.The unstable plaque is prone to rupture and lead to formation of thrombus in atherosclerotic plaque,which participated by dysfuntional vascular endothelial cells,smooth muscle cells and macrophages.The unstable plaque is characterized by large lipid core and thin fibrous cap.Further research on the mechanism of unstable plaque will provide new clue for the prevention and treatment of cardiovascular disease.In the atherosclerotic plaque,macrophages transform to foam cells and accumulate in plaques through phagocytosis lipid.The foam cell play a vital role in the release of cytokines,death of smooth muscle cell,secretion of matrix metalloproteinase and degradation of plaque collagen,promote plaque formation and increased plaque instability.Therefore,it is an important mean to reduce the instability of plaque by reducing the accumulation of macrophages and inhibiting the release of inflammatory cytokines.Functional blocking extracellular matrix Metalloproteinase?EMMPRIN?with monoclonal antibody or statins intervention in atherosclerosis mice model increased proportion of smooth muscle cells and collagen fibers and reduced EMMPRIN m RNA and protein expression levels,inflammatory reaction in peripheral blood,MMPs level,lipid core and proportion of macrophages in the atherosclerotic plaques.The above result indicated that EMMPRIN can change cells proportion,and promote plaque inflammation which lead to increased plaque instability.EMMPRIN promote the accumulation of macrophage and inflammatory reaction in the plaque,which will trigger secondary necrosis and induce degradation of collagen fibers.Therefore,we believe that EMMPRIN is the key factor to promote the instability of AS plaque,and it plays an important role in the accumulation and biological function of macrophages.But it is still not clear that how EMMPRIN increase the proportion of macrophages and amplification of inflammatory response in the plaque.Recent research suggested that macrophages have been developed a variety of strategies in adverse environments and initiated cellular protective mechanisms such as the activation of autophagy,unfolded protein response,and increased the anti-apoptotic protein to promotes cell survival.Autophagy is a physiological phenomenon in eukaryotic cells characterized by the formation of autophagosome with a double membrane structure.The basic or moderate autophagy is an important way to protect the cells against inflammation and oxidative stress,which is very important to keep the stability of AS plaque.Activation of macrophages autophagy plays a protective role in the early stage of atherosclerosis.With the progression of the disease,the loss or deficiency of macrophage autophagy promoted the inflammatory reaction,oxidative stress and cell necrosis in the plaque.In the high-fat feeding rabbit atherosclerosis model,the use of drugs?everolimus,classical autophagy inducer?reduced atherosclerotic plaque macrophages by increasing autophagic cell death.Therefore,we believe that the autophagy of macrophages is closely related to cell viability and inflammation,which influence the stability of plaque.To investigate whether EMMPRIN regulates plaque stability by autophagy,we first need to clarify whether the expression and function of EMMPRIN are related to the level of autophagy.The increased expression of EMMPRIN reduced cell death through regulation of apoptosis and autophagy in human liver cancer cells;berberine downregulates the expression of EMMPRIN and mediated liver tumor cell death;.EMMMPRIN inhibited starvation induced autophagy through down-regulation of beclin-1 in human hepatocellular carcinoma cell line SMMC7721.In conclusion,EMMPRIN regulates autophagy and affects cell viability in tumor cells.However,whether EMMPRIN is involved in the regulation of autophagy in macrophages in the plaque is obscure.We assumed that EMMPRIN in macrophages may affect cell viability and ability to promote inflammation and ultimately regulate plaque stability process through the regulation of autophagy level in the progression of atherosclerotic plaque.Our study intends to investigate as follows?1?establish atherosclerosis model using Apo E deficient mice?2?to observe the changes of the stability of plaque through the overexpression or intervention of EMMPRIN expression by adenovirus infection?3?analysis the relationship among EMMPRIN expression level and plaque stability and macrophage autophagy?4?detection of the macrophages autophagy level with EMMPRIN intervention in vitro and screen out the corresponding signaling pathways and the molecular mechanism.To investigate the relationship between level of autophagy in macrophages and the stability of the plaque will provide a new direction and target for the treatment of acute coronary syndromeMETHODS 1.Construction of adenoviral vectors The sequence was designed according to the literatures EMMPRIN?h EMMPRIN,Gen Bank,NO:NM001728.3?1: 5'GCAGCGGTTGGAGGTTGTAG primers 3',2: 5'GGCGCAGACGTGGAGCAG 3'.After amplification,conversion,linked to a vector,the plasmid of EMMPRIN Sal I+Pst I double enzyme cutting and recovery DNA strip belt.After screening and identification,connecting adenovirus backbone plasmid Adtrack,enzyme cutting successful reorganization of identification p Adeasy-Adtrack-EMMPRIN and packaging of recombinant adenovirus,named Ad-h EMMPRIN;EMMPRIN?Gen Bank accession NO:001077184.1?interference recombinant adenovirus expression plasmid named Ad-si/m EMMPRIN purchased from the Zimmer.Purified virus titer was above 109,which can satisfy the requirements of the transfection in vitro and in vivo.2.Effects of EMMPRIN on the stability of plaque through regulation of macrophage autophagy Animal experiments were divided into two parts: 1.Study on the relationship among the expression level of EMMPRIN,instability of atherosclerotic plaque and macrophage autophagy.2.To observe the effect with adenovirus or autophagy inhibitor intervention in mouse model of atherosclerosis,including the EMMPRIN changes in plaque,macrophages autophagy and plaque instability.Animal were purchased from the animal center of the Peking University of the male Apo E-/-mice,6-8 weeks old,weighing 16-20 g.Animal were feeded with conventional mouse pellets mixed 1.5% cholesterol and 20% fat.1.The animal were randomly divided into 3 groups including 0 weeks group(n=10,fed with high-fat diet for 0 weeks,8 weeks?n=10 group,high fat diet for 8 weeks?,20 weeks?n=10 group,high fat diet for 20 weeks?.The mice were sacrificed at 20 weeks.The stability of plaque was assessed by HE,immunohistochemistry,Sirius red staining.Immunofluorescence wa used for detection of CD68,EMMPRIN and SQSTM1 positive macrophages?representing the expression level of autophagy?.Expression of EMMPRIN,LC3 and SQSTM1 were detected in vascular tissue by Western blot.2.The experimental animals were divided into 4 groups randomly.After 12 weeks of high fat diet fed,the blank control group?n = 10?were given saline treated as blank control.Empty vector group?n = 10?receive empty virus suspension by intraperitoneal injection?4 weeks,2 times / week?.EMMPRIN inhibition group?n = 10?receive si EMMPRIN adenovirus suspension by peritoneal injection?4 weeks,2 times / week?inhibition of autophagy group?n = 10?receive si EMMPRIN adenovirus suspension by intraperitoneal injection and autophagy inhibitor CQ suspension was injected into the tail vein?4 weeks,2 times / week?.At the end of 16 weeks,the mice were sacrificed and the blood lipid level was tested.Plaque stability was tested and evaluated using he,immunohistochemistry,Sirius red staining method.Immunofluorescence wa used for detection of CD68,EMMPRIN and SQSTM1 positive macrophages?representing the expression level of autophagy?.Serum inflammatory cytokines?TNF alpha,IL-6,MCP-1,IL-10,NF kappa B?level were detected by ELISA.3.Molecular mechanism of EMMPRIN regulation of autophagy in macrophages Autophagy and cell biological function changes was detected by transmission electron microscope using si RNA EMMPRIN,ad-h EMMPRIN and ad-si EMMPRIN.LC3 and SQSTM1 expression were detected by Western blot.flow cytometry was used to detect the cell cycle,apoptosis.CCK8 assay was used to assess cell viability.Cell expression of inflammatory factor level were detected by ELISA.At the same time,the expression of key protein molecules related to autophagy which was closely related to the change of EMMPRIN were detected by Western blot.In the condition of ox LDL as stimulating factors and macrophage EMMPRIN was inhibited,we use autophagy inhibitors to observe the changes of the level of autophagy,EMMPRIN levels and cell biology function changes.EMMPRIN,LC3 and SQSTM1 was detected by Western Blot.Flow cytometry was used to detect cell cycle and apoptosis.CCK8 was used to detect the cell viability.ELISA was usedto detect the expression level of inflammatory cytokines..RESULTS 1.The recombinant adenovirus vector expressing the mouse EMMPRIN was successfully constructed.Through repeated amplification,the virus titer was about 3 * 109 pfu/ml.After 3,7 and 14 days transfection in vivo,EMMPRIN protein levels reached the highest in 3 days,still continued to rise in 7 and 14 days,which indicates that the constructed plasmid reached the requirements in the body.Then the virus was transfected into cells and the counting showed that the transfection efficiency was 92.6 + 7.4% and the transfection efficiency was achieved.The successful construction of adenovirus vector provides the basis for further study of the biological function of EMMPRIN and the intrinsic mechanism of macrophage autophagy.2.Overexpression of EMMPRIN can increase the instability of plaque by inhibiting autophagy of macrophages The first part of the results suggested that the 8 week of animal blood vessels start to form typical atherosclerotic lesions.The stability of the plaque was significantly decreased in 20 weeks compared to the 8 week.The expression of EMMPRIN and SQSTM1 increased significantly in the blood vessel.And the instability index,the EMMPRIN expression rate and the SQSTM1 expression rate was correlated.Therefore,the expression of EMMPRIN in macrophages in atherosclerotic plaques is related to the level of autophagy and the stability of plaque.The total protein expression of EMMPRIN increased but the expression of SQSTM1 did not significantly change.The second part of the results showed that compared with the control group,the intervention of EMMPRIN expression lead to increased stability of the plaque,decreased serum levels of inflammatory factors and decreased SQSTM1 expression which means that the higher level of macrophage autophagy.Therefore,inhibition the expression of EMMPRIN in macrophages may increase the level of autophagy and reduce the inflammatory response and increase plaque stability.Compared with the si EMMPRIN group,the stability of the plaque was significantly decreased in the autophagy intervention group and the SQSTM1 was accumulated in the macrophage.The serum levels of inflammatory factors increased.The above results suggested that EMMPRIN affect thelevel of plaque stability and serum inflammatory factors by regulating the level of autophagy in macrophages.3.EMMPRIN mainly regulates macrophage autophagy and affect cell biology function through activation of NF-kappa B pathway Silencing the expression of EMMPRIN using si RNA or adenovirus can increase the level of autophagy in macrophages and lead to decreased cell proliferation,apoptosis,secretion of inflammatory cytokines?TNF alpha,IL-6,MCP-1?.However,opposite results were observed when overexpression of EMMPRIN.EMMPRIN overexpression can promote macrophage proliferation apoptosis and increased the amount of plaque active macrophages and macrophage cell death,promoting the secretion of inflammatory cytokines and inhibition of autophagy level.Screening of multiple autophagy related pathways by western blot,it was found that the changes in the expression of EMMPRIN has a significant effect on NF kappa B pathway.In EMMPRIN knock down macrophages,lower levels of autophagy was observed when activate the NF kappa B pathway,suggesting that EMMPRIN may inhibit macrophage autophagy through the activation of the NF-B pathway.In addition,expression of EMMPRIN decreased when using the NF kappa B pathway inhibitor in macrophages,indicating that the expression of NF kappa B may turn to has a promoting effect for EMMRPIN expression,which formed a positive feedback loop.Based on the above research results,we draw the following conclusions: we have successfully constructed the atherosclerosis mouse model by high fat diet feeding Apo E gene knockout mice.The increase of unstable plaque was observed in mice model with increased EMMPRIN expression and declined level of autophagy in plaque macrophage.In adenovirus treated mice,inhibition of EMMPRIN expression lead to the increased stability of atherosclerotic plaque,increased level of autophagy of macrophages and decreased serum inflammatory factor expression.These results suggest that EMMPRIN expression levels may be related to macrophage autophagy level and plaques instability in atherosclerotic plaque.Downregulation of EMMPRIN expression by use of si RNA or adenovirus in macrophage,we confirmed that EMMPRIN can inhibit macrophage autophagy by activation of NF-kappa B pathway,thus affecting macrophage proliferation,apoptosis,pro-inflammatory.Our study shows that high expression of EMMPRIN inatherosclerotic plaques is a high-risk factors,which play a role by inhibiting the level of autophagy in macrophages and both of them are potential target for the treatment of unstable atherosclerotic plaque... |
PDF Full Text Request