Font Size: a A A

The Biological Function Of MicroRNA-107in Glioma And Glioma Stem Cells

Posted on:2014-06-16Degree:DoctorType:Dissertation
Country:ChinaCandidate:L ChenFull Text:PDF
GTID:1264330425950626Subject:Surgery
Abstract/Summary:
Glioblastoma multiforme (GBM) is the most common, aggressive and lethal intracranial tumor in adults and has the characteristics of rapid diffusely infiltrative growth, the inherent complexity of the tumor and easy to relapse. Current therapeutic options, including surgery, radiation and adjuvant chemotherapy, are not particularly effective in the treatment of GBM. Over the past decade, the median survival of GBM has remained12months or less. There is growing evidence that a small subpopulation of glioma cells,designated glioma stem cells (GSCs),has an increased potential for tumor initiation and repopulation. GSCs have also been referred to as CD133+glioma cells and show similar characteristics to neural stem cells, including capacities for neurosphere formation, proliferation,self-renewal, and multi-lineage differentiation. Some researchers believe that GSCsare responsible for resistance to radiotherapy and chemotherapy and for glioma relapse.identification of novel candidate factors involved in glioma and GSCs tumorigenicityis thus essential for effective targeted therapy for GBM.MicroRNAs (miRNAs)are a class of endogenous small non-coding RNAs that regulate gene and protein expression at the post-transcriptional level by direct cleavage of the target mRNA or by inhibition of protein synthesis. MicroRNAs negatively regulate gene expression at the post-transcriptional level intwo different ways depending on the degree of complementary between the miRNAand the target. In plants, miRNA binds with near-perfect complementary to proteincoding mRNA sequences and the messenger is cut and degraded. In animals, themiRNAs bind more frequently to3’UTR of mRNA with imperfect complementary,resulting in translational inhibition. Bioinformatics and other analyses have disclosed that an estimated one-third of all human genes are regulated by microRNAs.A number of miRNAs have been identified in gliomas and appear to participate in tumorigenesis as either oncogenes or tumor suppressors.several miRNAs have been shown to play important roles in proliferation, migration, and invasion of glioma cells. For instance, Let-7microRNA inhibits glioma growth, miR-146b inhibits glioma cell migration and invasion by targeting matrix metalloproteinase-16. Several miRNAs,including miR-124,miR-137,miR-451,miR-34a and miR-125b,have also recently been found to be involved in GSCs proliferation, differentiation and apoptosis.MiR-107is located at chromosome10q23.31. Profiling studies have led to the identification of microRNA-107(miR-107) as one of the several microRNAs dysregulated in different cancer types, such as prostate cancer, gastric cancer, head-and-neck squamous cell carcinoma, non-small cell lung cancer, and pancreatic cancer. However, the specific function of miR-107in tumorigenesis of glioma was not clarified.our experiment will investigate the miR-107expression in gliomas and glioma stem cells. We will also study the effect of miR-107on gliomas and glioma stem cell proliferation, invasion.Moreover, we also want to further explore the internal mechanism thatthe effect of miR-107on gliomas and glioma stem cell proliferation, invasion.Chapter I P53-induced microRNA-107inhibits proliferation of glioma cells and down-regulates the expression of CDK6and Notch-2Objective:We use RT-PCR assayTo investigate the miR-107expression in glioma tissues and cells. Meanwhile, we also study the effect of overexpression or inhibition of miR-107expresion on glioma proliferation and cell cycle.We also wantTo know the effect of p53on the expression of miR-107. Moreover, we also want to investigate the specific mechanism that miR-107can regulate glioma proliferation.Methods:1Quantitative real-time RT-PCR was used to test the expression of miR-107in glioma tissues [3of low-grade gliomasamples (WHO Ⅱ),11of high-grade glioma (WHOⅢ and WHOⅣ) samples] and cell lines (U87, U251and A172).2P53plasmid construction and transfection.To construct a p53expressing plasmid,p53DNAwasamplified(forward,as GCCGGATCCACCATGatggaggagccgcag tcaga, and reverse,as GCCGAATTC tcatcagtctgagtcaggccctt) and cloned into pcDNA3.1(+)vector. For transfection,1×105cells were seededinto each well of six-well plates and grownfor24h. Glioma celllines were transfected with the p53expression plasmid usingLipofectamine2000,accordingto the manufacturer’s instructions(Invitrogen, USA).After6h, the medium was changedwith the complete medium(DMEM/12). Following48h of culture, the RT-PCR quantificationmethod was employed to determine the expression levels of miR-107in U87, U251and A172glioma cells respectively.3Lentivirus construction and transduction. The pre-miR-107overexpression vector was constructed byligating the miR-107precursor into EcoR1and BamH1sites of thepSIN-EF2-IRES-GFP-puro lentiviral vector. Following generation of the pSIN-EF2-miR-107-IRES-GFP-puro vector, HEK293packagingcells were plated and transfectedwith three plasmids [(lentiviral transfer vector (20ug), psPAX2(15ug), and pMD2.G (5ug))]. After72h, the lentivirus in the supernatant was harvested and concentrated to a final vector titer of7.8×107TU/ml.Lentivirus wasthen transduced into the glioma cell lines, including U87and A172, using thecationic polymer, Polybrene. Stable clones were obtained using antibiotic selectionfor within one weekfollowing the transducing.Thecontrol lentiviral transfer vector, designated Lenti-GFP, stably expressed GFP, while the miR-107lentiviral transfer vector, Lenti-GFP-miR-107, stably expressed GFP and miR-107.In our experiment, all cells were divided into three groups anddesignated as the control (untreated), GFP (transduced with GFP only) andmiR-107groups (transduced with GFP and miR-107). 4Cell proliferationassay. Cell proliferation was assessed using Cell Counting Kit-8. The glioblastoma cells of U87and A172cell lines transduced with Lenti-GFP-miR-107or Lenti-GFP and parentalcells were seeded at a density of5.0×103cells per well in96-well plates, with six replicate wells. At6,12,24,48and72hafter seeding,10μ1of CCK-8solution was added to each well, andthe cells incubated for an additional4h. The optical density (OD)value of each sample was measured at a wavelength of450nmon an enzyme-linked immunosorbent assay plate reader. The formula (AC-AT)/AC×100%(AC=absorbancevalue of the blank control group; AT=absorbance value of thetreated group) was used to determine the cell growth inhibitionrate. Experiments were performed in triplicate.5Cell cycle assay. The effects of miR-107on cell cycle progression were assessed by staining with PI solution, according to the manufacturer’s instructions. U87and A172glioblastoma cells transduced with Lenti-GFP-miR-107or Lenti-GFP and the parental cells were harvested and washed with phosphate buffered saline (PBS). Next, cells were centrifuged at1000×g, for3min at4℃. The supernatant was discarded, and lml PI and10μL permeabilization solution were subsequently added to1×106cells for30min at room temperature. Cell samples were analyzed using flow cytometry (Becton Dickinson). All experiments were repeated at least three times.6Western blot analysis.The proteins of U87and A172cells transduced with Lenti-GFP or Lenti-GFP-miR-107and the parental cells were extracted with RIPA lysis buffer (150mMol/LNaCl,10mMol/L Tris, pH7.5,1%NP40,1%deoxycholate,0.1%SDS. The Pierce BCA protein assay kit was employed to assess protein concentrations. Protein samples (30μg per lane) were resolved using SDS-PAGE, and then transferred to PVDF membranes. After blockage of nonspecific binding sites, samples were incubated for12h with primary antibodies, specifically, rabbit polyclonal to Notch-2and mouse monoclonal to CDK6, followed by incubation with the corresponding secondary antibodies. Immunoblots were visualized using an enhanced chemiluminescence (ECL) Western Blotting Detection System. GAPDH was used as the loading control. 7Statistical analyses were performed using SPSS version13.0(SPSS, Chicago, IL, USA), and values expressed as "mean values±SD". One-way ANOVA or Student’s t-test was used to determine significant differences between groups. Data were considered statistically significant at p<0.05.Results:1Expression of miR-107in glioma tissues (3of low-grade gliomasamples,11of high-grade glioma samples) and cell lines (U87, U251and A172) is down-regulated,particularly in the p53-mutant U251and A172cells.2After transfection of wild-type p53plasmid, the miR-107expression levels in all three glioma cell lines were up-regulated.3Our data showed a significant increase ofmiR-107expression levels after cells were transducted with Lenti-GFP-miR-107.4Glioma cell growth in vitro was examined with the CCK-8assay. U87glioma cells transduced with Lenti-GFP-miR-107displayed5.33±1.07%,13.08±1.51%,14.24±1.16%,21.22±0.20%and23.72±1.31%growth inhibition at6,12,24,48,and72h, respectively. Overexpression of miR-107in A172glioma cells ledto10.81±2.17%,13.87±0.85%,17.15±0.27%,18.00±1.41%and21.88±2.07%growth inhibition at6,12,24,48and72h after cellseeding, respectively.5Glioma cell cycle progression was assessed using the propidiumiodide flow cytometry assay. In the U87group, the G0/G1phasefractions of control, Lenti-GFP and Lenti-GFP-miR-107cells were51.42±0.98%,52.66±0.88%and70.3±1.24%, respectively. Similarly, miR-107induced an increase in the G0/G1phase fractionin A172glioma cells from60.64±0.40%to77.10±0.74%.6We employed the bioinformatics tools, miRBase (http://www.mirbase.org/) and Target Scan (http://www.targetscan.org/), topredict the target genes of miR-107. Several target genes of miR-107were identified, including CDK6and Notch-2. Theeffects of miR-107on the protein levels of CDK6and Notch-2weredetermined with Western blot analysis, inU87and A172glioma cell lines, CDK6and Notch-2protein levelswere clearly suppressed following transduction with Lenti-GFP-miR-107.Conclusion:In summary, data from the current study show that miR-107expression is down-regulated in both glioma tissues and cell lines, andwild-type p53is a transcriptional regulator of miR-107. Moreover, miR-107inhibits the proliferation of the glioma cells, and arrests the cell cycle of them at the G0-G1phase in vitro. Transduction of Lenti-GFP-miR-107into glioma cells inhibits the expression of both CDK6and Notch-2. These results support the potential utility of miR-107as a therapeutic agent for brain tumor.Chapter II MicroRNA-107inhibits glioma cell migration and invasion by modulating Notch2expressionObjective:We will investigate the effects of microRNA-107and Notch2shRNA on glioma cell migration and invasion respectively. We will also want to further study the role of microRNA-107on Notch2, as well as the intrinsic molecular mechanisms thatmicroRNA-107inhibits glioma migration and invasion.Methods:1Real-time qRT-PCRwas employed to test the expression of Notch2,Tenascin-C, MMP-12and Cox-2mRNA.2Lentivirus construction and transduction (Similar to the first Chapter).3Notch2shRNA construction and transfection.4To establish a wound healing model with a transwell system to assaythe effect of miR-107on migration of the gloma cells in vitro.U87and A172glioma cells transduced with Lenti-GFP-miR-107or Lenti-GFP and the parental cells were seeded in six-well platesat adensity of3×105cells per well, and allowed to grow to80% confluence in complete medium with10%FBS. Monolayers were scratched with a10μl plastic pipette tip to create a uniform wound. After wounding, the debris wasremoved by washing cells with phosphate buffered saline (PBS), followed by incubation for a further24h. The migratory distance was measured under a microscope equipped with acamera. Photographs of three random fields were obtained, and cell migration ability expressed as closure of gap distance.5In vitro matrigel invasion assay.BD BioCoat matrigel invasion chambers were used to examine the effects of miR-107expression on cell invasion. U87and A172glioma cells (3×105) were transduced with Lenti-GFP-miR-107or Lenti-GFP. Parental cells wereresuspended in100μl of serum-free medium and then added to the upper chamber, while the lower chamber was filled with600μl of complete medium containing10%FBS. After incubation at37℃for24h, cells on the membrane surface of upper chamber were removed.while the ones on the lower membrane surface were fixed in4%formaldehyde and then stained with0.1%of crystal violet. Invading cells were manually counted from five randomlychosen fields under a microscope, and the photographs were obtained.6Western Blot Analysis.U87and A172cellstransduced with Lenti-GFP or Lenti-GFP-miR-107and the parent cells were extracted with RIPA lysis buffer (150mMol/L NaCl,10mMol/L Tris, pH7.5,1%NP40,1%deoxycholate, and0.1%SDS). The bicinchoninic acid (BCA) protein assay kit was employed to assess protein concentrations. Protein samples (30μg per lane) wereseparated using SDS-PAGE and then transferred to PVDF membranes. Proteins were detected by incubation with primary antibodies, followed by secondary antibodies Immunoblots were visualized using a MilliporeECL Western Blotting Detection System. GAPDHwas employed as the loading control.7Statistical Analysis. All data are presented as "mean values±SD". Statistical analyses were performed using SPSS version13.0(SPSS, Chicago, IL, USA), and significance determined with Student’s t-test or one-way ANOVA. Data were considered statistically significant at p<0.05. Result:1MiR-107inhibits glioma cell migration and invasionin vitro.At24hour after scratching, migration of U87and A172cellsoverexpressing miR-107was inhibited by33%and25%, compared with their control cell counterparts, respectively. Moreover,overexpression of miR-107in the U87and A172cell types led to45%and47%reduction in invasion, compared to control cells, respectively.2Knockdown of Notch2suppresses the invasion extent of U87and A172cell by29%and22%, respectively,compared with the effects of miR-107.3Up-regulation of miR-107suppresses mRNA and protein expression levelsof Tenascin-C, MMP-12, and COX-2. To furtherelucidate the molecular mechanism underlying miR-107-mediatedinhibition of glioma cell migration and invasion, the?? levels of Tenascin-C, MMP-12,and Cox-2involved in the migratory and invasive processes were examined using real-time qRT-PCR. Notably, the mRNA levels of Tenascin-C, MMP-12, and Cox-2were down-regulated in cells transduced with Lenti-GFP-miR-107. The western-blot assay showed thatTenascin-C, MMP-12,and Cox-2protein expression levels were inhibited after U87and A172cell were transduced with Lenti-GFP-miR-107.Conclusion:MiR-107expression levels are also reduced in glioma cell lines and play a role in inhibition of glioma cell migration and invasion. Furthermore, miR-107is involved in the modulation of Notch2/Tenascin-C/MMP-12and Notch2/Cox-2signaling. miR-107may also exertits anti-invasiveeffect through Notch2signaling pathways.These results support the potential utility of miR-107as a candidate therapeutic agent for brain tumor. ChapterⅢ MicroRNA-107inhibits U87glioma stem cells growth and invasionObjective:We will test the expression of microRNA-107in CD133+glioma stem cells. we will also investigate the effect of microRNA-107on glioma stem cell proliferation, invasion and its regulation mechanismMethods:1Sorting and purity of CD133+cells.For cell sorting,l X107of primary glioblastoma cells, U87and A172cells respectively,werelabeled with10μl anti-human CD133/2(293C3)-allophycocyanin(APC) in the dark at4℃for10min. Mouse IgG2b monoclonal antibodies were used as a negetive control. After CD133staining, cells were sorted using a BD FACSAria II withCell Quest Pro software. The purity of the CD133+cells was analyzed using a similar protocol.All of the sorted cells were stained with CD133/1(AC133)-PE. The purity of the sorted cells was then tested by flow cytometry using a FACSCalibur.2RNA extraction and Real-time qRT-PCR to test the expression of miR-107,CD133,Nestin,MMP-2,MMP-9andMMP-12。3Lentivirus construction and transduction ((Similar to the first Chapter))4Neurospherecultures.CD133+U87glioma cells transduced with lentivirus-miR-107or control were plated in24-well culture plates at2×105cells per well.All cells were resuspended in DMEM/F12medium supplemented with20ng/ml basic fibroblast growth factor(bFGF, Peprotech, Rocky Hill, NJ, USA),20ng/ml epidermal growth factor(EGF, Peprotech)andB27(100μl,Gibco-Invitrogen). Neurospheres were seen in all wells72h later.5Invasion assay.BD BioCoat Matrigel invasion chambers were used to examine the effects of miR-107on GSC invasion.Briefly, CD133+U87cells(2×105) transduced with lentivirus-miR-107or lentivirus-control were resuspended in100μl of serum-free medium and added to the upper chamber,while the lower chamber was filled with600μl of complete medium containing10%FBS. Cells on the upper membrane surface were removedafter incubation for24h at37℃. Cells on the lower surface of the membrane were fixed in4%of formaldehyde and stained with0.1%crystal violet. Invasive cells were countedand photographed in three randomly chosen microscope fields at a magnification ofx200.Given that CD133+glioma cells have the ability to form neurospheres in serum-free medium, we also assessed the invasive ability of GSCsby measuring the migration ability of cultured neurospheres. Neurospheres with similar diameters were selected and plated onto24-well culture plates coated with poly-L-ornithine (10μg/ml).After24-h incubation in DMEM/F12medium, the invasive ability of the GSCs was quantified by measuring the distance between the edge of the neurosphere and the periphery of the radially-spreading cells.6Western blot analysis.CD133+U87cells transduced with lentivirus-miR-107or lentivirus-control were solubilized in RIPA lysis buffer. Proteins (30μg)were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis,transferred to polyvinylidene difluoride membranes and probed with primary antibodies(rabbit polyclonal to Notch-2,1:500, Abcam; rabbit polyclonal to MMP-2,1:500, Abcam;rabbit polyclonal to MMP-9,1:1000, Abcam;rabbit polyclonal toMMP-12,1:200, Santa cruz biotechnology), followed by incubation with secondary antibodies (goat anti rabbit IgG, horseradish peroxidase conjugate,1:1,000, Sigma,USA). Immunoblots were visualized using Millipore ECL Western Blotting Detection System(Millipore, USA). Loading was normalized with GAPDH.7Statistical analysis.Statistical analyses were performed using SPSS version13.0(SPSS, Chicago, IL, USA).Data are expressed as mean values±SD. All data were analyzed by Student’s t-test or one-way ANOVA. A pvalue<0.05was considered significant.Results:1MiR-107is down-regulated in CD133+glioma cells.CD133+and CD133-glioma cells were sorted by fluorescence-activated cell sortingusing the CD133/2(293C3)-APC antibody. After sorting, the purity of the CD133+cell fraction was tested by flow cytometry using CD133/1(AC133)-PE antibody. The ratios of CD133+cells in GBM, U87and A172glioma cells were increased from7.2%to85.4%,1.1%to80.5%and from1.2%to63.7%, respectively, after cell sorting。 The expression of miR-107in CD133+and CD133-glioma cells was examined by quantitative real-time reverse transcription (RT)-PCR. MiR-107levels were significantly downregulated by2-4fold in the CD133+fractions compared to theCD133-fractionsderived from GBM,U87andA172glioma cells. Thesefindings suggest that miR-107may play an important role in CD133+glioma cells.2Upregulation of miR-107inhibits growth and reduces Notch2, CD133and Nestin expression in CD133+U87glioma cells.3Upregulation of miR-107inhibits invasive ability and reduces MMP-12expression in CD133+U87cells.4Matrigel invasion assays were performed to investigate the effects of miR-107on GSCs invasion. Over-expression of miR-107led to a28%reduction in invasion compared to control CD133+U87cells (Fig.3A and3B).In addition, the invasive ability of GSCs was also assessed by their migration from neurospheres when attached to coated plates in culture. We selected neurospheres with similar diameters from lentivirus-miR-107and lentivirus-control-transduced CD133+U87cells and measured the distances between the edges of the neurospheres and the peripheries of the radially-spreading cells after24h. Ectopic expression of miR-107caused a28%reduction in thedistance from the edge of the spheres compared to thelentivirus-control group(Fig.3C and3D).MMP-2and MMP-9play important roles in glioma invasion. To further explore the mechanism by which miR-107inhibits CD133+U87cells invasion, we therefore examined the expression levels of MMP-2and MMP-9mRNAs. MMP-2and MMP-9mRNA levels were similarin lentivirus-miR-107-transduced and lentivirus-control-transduced CD133+U87cells (Fig.3E and3F). Moreover, MMP-12mRNA expression was indirectly regulated by Notch2, and was inhibited by26%in lentivirus-miR-107-transduced compared tolentivirus-control-transduced CD133+U87cells (Fig.3G). We further examined the expression of MMP-2, MMP-9and MMP-12using Western blot assay. Our data showed that MMP-12protein levels were down-regulated instead of MMP-2and MMP-9after CD133+U87glioma cells were transduced with lentivirus-miR-107(Fig.3H).These data demonstrate thatup-regulation of miR-107may suppressthe invasive ability of CD133+U87cellsby inhibiting the expression of MMP-12.Conclusion:we confirmed that miR-107was down-regulated inGSCs.We found that over-expression of miR-107suppressed proliferation and down-regulated Notch2protein and stem cell marker (CD133and Nestin) expression in U87GSCs. Furthermore, enhanced miR-107expression significantly inhibited U87GSC invasion and reduced matrix metalloproteinase-12(MMP-12) expression. These findings suggest that miR-107is involved in U87GSCs growth and invasion and may provide a potential therapeutic target for gliomatreatment.
Keywords/Search Tags:Glioma, glioma stem cell, microRNA-107, cell proliferation, tumor invasion, Notch2
Related items