TGF-β1 Associated With Increased Expression Of Connective Tissue Growth Factor To Induce Hypertrophy Of Ligamentum Flavum Via P38 MAPK Pathway

1. BackgroundLumbar spinal stenosis (LSS) is one of the most common spinal disorders in the elderly patients. Degenerative changes in the posterior structures of the lumbar spine, such as hypertrophy of the facet joints and ligamentum flavum (LF) in combination with degenerative spondylolisthesis can contribute to the development of LSS. The hypertrophy of the LF has been described in anatomic studies to be 7 to 8 mm thick in patients with central stenosis, versus the usual 4 mm or less. Although it is agreed that spinal mechanical stress and secreted cytokine from herniated disk accelerates the hypertrophy of LF which contributes to the development of LSS, the detailed underlying mechanism is not well understood.Continuous mechanical stress causes degeneration of the LF. Common pathol-ogical characteristics in the degenerated LF are the loss of elastic fibers and tissue fibrosis, and increased collagen tissues. Mechanical stress increases the production of TGF-β1 in several cell lines, including LF cells isolated from surgically resected LF. TGF-β1 is a key factor in pathogenesis of tissue fibrosis and is abundantly expressed in hypertrophied degenerative LF tissues from LSS. TGF-β1 activates collagen expression in LF cells. These previous study suggested that TGF-β1 plays important roles in LF hypertrophy in the pathogenesis of LSS. However, the molecular mechanism underling the association between TGF-β1 and LF hypertrophy, especially the mechanism underline TGF-β1 activates collagen expression has not been fully elucidated.Recently, connective tissue growth factor (CTGF) was suggested an increased expression in hypertrophied lumbar LF and to involve in the LF hypertrophy. CTGF is a pro-fibrotic factor involved in the fibrotic process, such as cell proliferation, migration, adhesion, and extracellular matrix (ECM) accumulation. CTGF has been also reported to involve in the biological activities by TGF-β1. For example, TGF-β1 associated with CTGF in regulation of cell proliferation and synthesis of ECM components. TGF-β1 could induce the mRNA expression of CTGF in human skin fibroblasts. TGF-β1 is also a well-known inducer of ECM components such as collagen and fibronectin. In the presence of CTGF neutralizing antibody (CTGF NA), the pro-fibrogenic effects of TGF-β1 were attenuated in fibroblast, such as collagen deposition and anchorage-independent growth. So we suppose blocking the TGF-β1 or the expression of CTGF induced by TGF-β1 could be inhibit hypertrophy and proliferation of LF cell.Additionally, MAPKs were reported to involve in the regulation of expression of CTGF. However, whether the expression of CTGF regulated by TGF-β1 in LF cells and involved in the LF hypertrophy though MAPKs pathway remained unknown.2. ObjectionIn this study, we investigated the viability of cultured human LF cells, the roles of TGF-β1/CTGF in proliferation of LF cells and LF hypertrophy, and the importance of MAPKs pathway in the pathogenesis of LSS by analyzing CTGF and ECM components (Collagen Ⅰ and Collagen Ⅲ) expressions in TGF-β1-treated LF cells obtained from LF tissues of patients who treated with posterior approach for lumbar fracture or with a standard nucleotomy for lumbar disc herniation with Love method.3. Materials and methods3.1 SamplesSpecimens from thirteen patients, who treated with posterior approach for lumbar fracture or with a standard nucleotomy for lumbar disc herniation with Love method in Zhujiang Hospital of Sothern Medical University, were collected. Informed consent was obtained from each patient, and this study was approved by the Ethics Committee of Sothern Medical University.3.2 Cell Isolation and CultureCells were isolated from the ligamentum flavum (LF) tissues as described previously. Briefly, specimens were minced with microdissection scissors under aseptic conditions and washed extensively with phosphate-buffered saline (PBS) to remove blood component. The minced tissue was digested at 37℃ for 60 min with 0.2% type Ⅰ collagenase (Sigma, USA) in serumless Dulbecco’s Modified Eagle’s medium (DMEM, Gibco, Australia). Collagenase-treated ligament chips were washed with serum-containing DMEM to inhibit collagenase The cells were filtered through a sterile nylon mesh filter (75μm of pore size), and placed in 35-mm Petri dishes at a density of approximately 5×104 cells/ml in DMEM supplemented with 10% fetal calf serum (Gibco). Cultures were incubated at 37℃ in a humidified atmosphere, air 95% and CO2 5%. The medium was changed at two-day intervals, and the explants were daily checked for cell outgrowth using an inverted light microscopy. The outgrown cells were harvested before confluence and subcultured after trypsinization with 0.2% trypsin/0.02% ethylenediamine tetraacetic acid (EDTA). The cells at the third-fifth passage were used for experiments. Immunofluorescence staining of collagen Ⅰ and Ⅲ, and fibronectin were used to identify the cell phenotype of cultured LF cells.3.3 The Viability of Cultured LF CellsViability of LF culture was evaluated using the MTT [3-(4,5-dimethyl-thiazol-2-y1) 2,5-diphenyl tetrazolium bromide] (Sigma, USA) colorimetric assay, that is based on the reduction of formazan crystals by living cells. Briefly, LF cells at passages 1,3, and 5 were seeded in 96-well tissue culture plates at 1×104 cells per well and incubated at 37℃ under 5% CO2 for Oh,24h,48h, and 72h, respectively. Then, cells was first washed with PBS and then incubated in 100μL of 5 mg/mL MTT solution (Invitrogen Inc., USA) for 4 h. MTT is converted into purple colored formazen in living cells which was then solubilized with dimethylsulfoxide (DMSO) (Invitrogen Inc., USA) and absorbance of solution was taken at 450 nm using the microplate reader Thermo Plate.3.4 Effect of TGF-β1/CTGF on LF CellsTo analyze the biological response of human LF cells to TGF-β1/CTGF, LF cultures were treated with 3 ng/ml TGF-β1 or 50 ng/ml CTGF in the absence or presence of CTGF neutralizing antibodies (1:500) for 24 h. The proliferation of LF cells was first performed using MTT assay, and then the mRNA expressions of CTGF, Collagen Ⅰ and Collagen Ⅲ were detected by quantitative Real-time Polymerase Chain Reaction (qRT-PCR), and the expression of CTGF in cell lysate was detected by Western blot.3.5 Role of MAPKs PathwayTo investigate the roles of MAPKs pathway in the TGF-β1-induced CTGF, Collagen Ⅰ and Collagen Ⅲ, LF cultures were treated with various MAPKs inhibitors including JNK inhibitor SP600125 (10 μM, EMD Biochemicals), ERK inhibitor PD985059 (10μM, EMD Biochemicals), and p38 inhibitor SB203580 (100 μM, EMD Biochemicals). Cell were pre-treated with indicated MAPKs inhibitor for 1h, and then with the addition of 3 ng/ml of TGF-β1 for 24h. Then, the mRNA expressions of CTGF, Collagen Ⅰ and Collagen Ⅲ were detected by qRT-PCR.In addition, to further confirmed the role of p38, we observed the expression of p38 and p-p38 on cells after treated with 3 ng/ml TGF-β1 for 2h,4h, and 6h by immunofluorescence staining, and performed the expressions of p38 and p-p38 on cells after treated with 3 ng/ml TGF-β1 for 30 min, 1h,2h, and 3h by Western blot.3.6 Validation of the Critical Role of p38 by p38 siRNAThe involvement of p38 in the TGF-β1-induced CTGF, Collagen Ⅰ and Collagen Ⅲ was further examined using siRNA-mediated knockdown of p38.the cells were cultivated for an additional 24 h following the treatment of 3 ng/ml TGF-β1 for 6 h. The expressions of p38 and p-p38 were detected by immunofluorescence staining, and its efficiency over time (0,12,24,36h) was also validated by RT-PCR (data was not shown). The mRNA expressions of CTGF, Collagen Ⅰ, and Collagen Ⅲ were detected by qRT-PCR. The expression of CTGF was detected by Western blot.3.7 Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)After mentioned incubation or treatment, total RNA was extracted using TRIZOL (Invitrogen Inc., USA), and subjected to qRT-PCR using the following primers:5’-GGAGTGGGTGTGTGACGAG-3’(forward) and 5’-GTCTTCCAGTCGGTAAGCCG-3’(Reverse) for CTGF, 5’-AGATCTGAAGTGTGATGACTCAGG-3’(forward) and 5’-CAGATCACGTCATCGCACAAC-3’(Reverse) for Collagen Ⅰ,5’-ATGTTCCACGGAAACACTGG-3’(forward) and 5’-GGAGAGAAGTCGAAGGAATGC-3’(Reverse) for Collagen Ⅲ, CGTGTTGCAGATCCAGACCA (forward) and GCCAGAATGCAGCCTACAGA and (Reverse) for p38 siRNA, and 5’-ACACCCACTCCTCCACCTTT-3’(forward) and 5’-TTACTCCTTGGAGGCCATGT-3’(Reverse) for GAPDH. Gene expression was normalized to the level of GAPDH within each sample using the relative ΔΔCT method. Gene expression is shown as relative expression to control. The data shown is representative of three independent experiments.3.8 Statistical AnalysisAll data were expressed as mean±standard error of the mean (SEM). One-way analysis of variance with Fisher’s protected LSD post-hoc test was performed to test the difference in densitometeric data. Two-way ANOVA test was performed to test interactions.Each experiment was repeated at least three times. The statistical significance level was defined asp< 0.05.4. Results4.1 The Viability of Cultured Human Lumbar Ligamentum Flavum CellsHuman lumbar LF cells were isolated from surgical specimens of 13 patients and cultured. Immunofluorescence staining were used to identify the cell phenotype. The cultured cells had a typical LF cell phenotype, and expressed uniformly collagen Ⅰ collagen and fibronectin in each cell, and very few type Ⅲ collagen. Cell growth assay revealed that there were no significant differences of cell growth rate among LF cell subcultures (Passages 1,3, and 5) at any experimental time point (0,24,48, or 72h) (P>0.05). During the 72 h, the proliferation of LF cells was significantly increased with time in each subcultures showing a similar viability with primary cultured LF cells.4.2 TGF-β1/CTGF Enhanced the Proliferation of Human Lumbar Ligamentum Flavum CellsBoth TGF-β1 and CTGF obviously elevated the proliferation of LF cells. Interestingly, the effects of TGF-β1 and CTGF on proliferation of LF cells could be attenuated by CTGF neutralizing antibody (CTGF NA) suggesting that TGF-β1 associated with CTGF.4.3. TGF-β1/CTGF induced mRNA Expressions of CTGF, Collagen Ⅰ and Collagen Ⅲ, and Expression of CTGF in cell lysate.TGF-β1 increased the mRNA expression of CTGF, and it was obviously abolished by CTGF NA. To further evaluate the influence of TGF-β1/CTGF on the hypertrophy of LF, we determined the mRNA expression of ECM components, such as Collagen Ⅰ and Collagen Ⅲ. TGF-β1/CTGF significantly increased the mRNA expression of Collagen Ⅰ and Collagen Ⅲ, respectively. Also, the presence of CTGF NA abolished the role of TGF-β1/CTGF in mRNA expressions of Collagen Ⅰ and Collagen Ⅲ, respectively. Meanwhile, we examined the expression of CTGF in cell lysate. CTGF in cell lysate was increased in the presence of TGF-β1 and CTGF, and diminished by the CTGF NA. Overall, these finding suggested TGF-β1/CTGF play an important role in hypertrophy of LF.4.4. The mRNA Expressions of CTGF, Collagen Ⅰ and Collagen Ⅲ in the TGF-β1-treated Cells were mediated by p38, but not JNK or ERK.The MAPKs inhibitors, JNK inhibitor SP600125 and ERK inhibitor PD985059, did not influence the mRNA expression of CTGF, Collagen 1 and Collagen Ⅲ. The p38 MAPK inhibitor SB203580 abolished the TGF-β1 induced mRNA expression of CTGF, Collagen Ⅰ and Collagen Ⅲ closed to the baseline level, respectively.4.5. Expressions of p38 and p-p38 in the TGF-β1-treated cells.The immunofluorescence imaging of p38 and p-p38 revealed that the expression and activity of them was directly related to the duration of TGF-β1. TGF-β1 gradually and slightly increased the expression of p38 in LF cells with time (P>0.05). TGF-β1 gradually elevated the expression of p-p38 with time and reached significant level at 1 h, showing TGF-β1 activates the p38 MAPK signaling pathway.4.6. The p38 siRNA attenuated the Roles of TGF-β1.Silencing the expression of p38 in LF cells significantly diminished the expression and phosphorylation level of p38, as well as TGF-β1 (3 ng/ml for 6 h)-enhanced p38 expression and activity compared with mock siRNA treatment. Similarly, silencing the expression of p38 in LF cells, the mRNA expression of CTGF, Collagen Ⅰ and Collagen Ⅲ in the presence or absence of 3 ng/ml TGF-β1 for 6 h, respectively, were significantly decreased compared with mock siRNA treatment. The expression of CTGF in cell lysate had similar trend with its mRNA expression. TGF-β1 (3 ng/ml for 6 h) increased the expression of CTGF, and this was diminished by the silencing of p38. Overall, the results presented above show that p38 MAPK signing pathway plays critical role in TGF-β1 enhanced hypertrophy of LF.5. DiscussionStenotic ligamenum flavum cells can produce a matrix rich in type Ⅰ and Ⅲ collagen and fibronectin, and the cultured cells underwent LF cell phenotyping with uniform expression of collagen Ⅰ and type Ⅲ collagen, as well as fibronectin in each cell.Hypertrophy of ligamentum flavum plays an important role in the development of lumbar spinal stenosis. Spinal mechanical stress and secreted cytokine from herniated disk accelerates the hypertrophy of LF. Mechanical stress increases the production of TGF-β1. The association between TGF-β1 and LF hypertrophy has not been fully elucidated before. We found that TGF-β1 could enhance the expression of connective tissue growth factor in both mRNA and protein levels, further supported the existence of interaction of CTGF and TGF-β1 as previous study described. And also, TGF-β1 elevated the mRNA expression of extracellular matrix components including Collagen Ⅰ and Ⅲ, which could abolished by the CTGF neutralizing antibody showing TGF-β1 contributed to the hypertrophy of ligamentum flavum is associated with the increasing CTGF. Furthermore, the associations among TGF-β1, CTGF, and LF hypertrophy are p38 MAPK mediated.Previous studies demonstrate that TGF-β1 associated with CTGF in regulation of cell proliferation. In this study, we found that TGF-β1 enhanced the proliferation of LF cells, and it was CTGF associated. If the role of CTGF was blocked by its neutralizing antibody, TGF-β1 could not enhance the LF cells proliferation. Furthermore, TGF-β1 also associated with CTGF in regulation of synthesis of ECM components. Increased synthesis of collagen is the major characteristic in LF hypertrophy. The LF cells had a typical fibroblast-like phenotype:they expressed type Ⅰ and type Ⅲ collagen and fibronectin. Type Ⅰ and type Ⅲ collagen have been found to be predominant in human ligamentum flavum. We also observed that TGF-β1 increased the mRNA expression of Collagen I and Collagen III, and it was attenuated by the CTGF neutralizing antibody indicating that TGF-β1-induced the synthesis of ECM components is associated with CTGF. TGF-β1 elevated the expression of CTGF in both mRNA and protein levels Therefore, TGF-β1 associated with CTGF contributing to the LF hypertrophy.In general, TGF-β action is mediated through phosphorylation of cytoplasmic R-Smads. In addition to activation of Smad signaling, TGF-β1 can activate members of the MAPK pathways as well as other kinases. Upon stimulation by TGF-β, crosstalk between ERK, p38, JNK and Smad pathway is cell type-specific. Previous studies have shown the pro-fibrotic activities of p38 and ERK signaling, and the anti-fibrotic activities of JNK signaling. The pathway involved in the TGF-β1 induced LF hypertrophy has not been addressed. Among the ERK, p38, and JNK, only the use of p38 inhibitor abolished the mRNA expression of CTGF, Collage Ⅰ and Ⅲ, suggesting the pro-fibrotic activities of p38 signaling. We further observed the expression and phosphorylation level of p38 were enhanced by TGF-β1. Silencing the p38 MAPK (its efficiency over time was almost the same, data not shown), the expression and phosphorylation level of p38, and the mRNA expression of CTGF, Collagen Ⅰ and Collagen Ⅲ were attenuated correspondingly. These results further confirmed p38 MAPK is a key mediator of TGF-β1 action, and the pro-fibrotic activities of p38 signaling.In conclusion, TGF-β associated with increased expression of Connective Tissue Growth Factor to induce Hypertrophy of Ligamentum Flavum via p38 MAPK pathway. Degenerative changes in the posterior structures of the lumbar spine, such as hypertrophy of the facet joints and ligamentum flavum in combination with degenerative spondylolisthesis contribute to the development of LSS. The patients with LSS usually presents with the typical symptoms of neurogenic claudication and/or lumbar or sacral radiculopathy. Many patients may also complain of pain with activities requiring extension of the spine. These symptoms could improve with appropriate conservative treatment, but sixty percent to 85% of patients have a surgical treatment. Our observations appear to be important to evaluate the pathomechanism of LSS, and could be helpful in the diagnosis and prevention of LSS in the early stage. It will be a great alternative to surgery.