Font Size: a A A

Long Noncoding RNA RP11-838N2.4 Regulate Temozolomide Resistance Of Glioblastoma Through Interacting With MiR-10a

Posted on:2017-04-26Degree:DoctorType:Dissertation
Country:ChinaCandidate:Y T LiuFull Text:PDF
GTID:1224330488983285Subject:Neurosurgery
Abstract/Summary:
INTRODUCTIONGlioblastoma (GBM) is one of the most common malignant tumors in central nervous system with a median survival of 15 months after patient diagnosis. Temozolomide (TMZ), an orally administered DNA-alkylating agent, has been the most potent chemotherapy applied in clinical in addition to surgical excision. Unfortunately, the outcome of GBM patient has not fundamentally improved because of the inevitably occurrence of TMZ resistance. So, predicting the effectiveness of TMZ in glioma patients and enhancing TMZ sensitivity are paramount importance. Recently, the main mechanisms underlying TMZ resistance involves epigenetic changing of O6-methylguanine DNA methyltransferase (MGMT) and mismatch repair (MMR). Nonetheless, a growing number of evidence has demonstrated that reduced MGMT levels or increased activity of MMR did not totally decreased TMZ resistance indicating there is some other obstacle need to elucidate.Long noncoding RNAs (lncRNAs), currently defined as transcription more than 200 nt in length, have showed function to influence diverse oncogenic signaling pathways and interact with multiple nucleotides or protein to regulate cell proliferation, apoptosis, invasion and vascularization. Increasing research showed that distinct lncRNAs expression levels could contribute to cancer formation, such as GBM, carcinoma, leukemia, lung adenocarcinoma, prostate cancer and colorectal cancer. Furthermore, with the in-depth annotation of lncRNAs, it has been emerged as key point of chemoresistance in cancer treatment. Documents have demonstrated that the distinct lncRNAs (ENST00000563280, NR-036444) induced doxorubicin-resistance of osteosarcoma by interacting with ABCB1, HIF1A and FOXC2. LncRNA UCA1 increases the cisplatin resistance of bladder cancer cells by enhancing the activation of Wnt signaling and lncRNA HOTAIR, high expressed in primary sarcoma, is positively correlated with a chemotherapy response. Therefore, genomic characterization of lncRNA alterations across the initial and progress of chemoresistance may lead to new diagnostic and therapeutic strategies for chemotherapy. Strikingly, Chen Y has summarized the different lncRNAs expression profiles in recurrent gliomas compared with primary gliomas treated with TMZ by microarray analysis. This result showed that more than 1,111 lncRNAs were differentially expressed between primary group and recurrent group, which have potential connection with the processes of cancer progression and pathogenesis. Nonetheless, there still few lncRNAs has been confirmed relative to TMZ resistance in GBM and the exactly mechanism underlying was still unclear.Recently, competing endogenous RNAs (ceRNAs) was an important mechanisms to elucidate how lncRNAs regulate coding genes relative to cancer biology functions. Thousands of lncRNAs act as scaffolds with enormous miRNAs that participate in regulating variety gene expression. For example, lncRNA NEAT1 promotes glioma pathogenesis by functions as a molecular sponge to miR-449b-5p resulting in up-regulation of c-Met. lncRNA H19, up-regulated after the induction of osteoblast differentiation, inhibited mRNA and protein expression of transforming growth factor-β1(TGF-β1) by interact with miR-675. Moreover, lncRNA UCA1 contributes to progression of hepatocellular carcinoma through inhibition of miR-216b and activation of FGFR1/ERK signaling pathway. Nevertheless, whether deregulated lncRNAs could impact TMZ resistance thought ceRNA was still largely unknown.In our study, we first established TMZ resistance GBM cell sublines U87TR and U251TR from parent GBM cell U87 and U251 respectively. Then the distinct lncRNAs expression of U87TR were compared with U87 by microarray analysis and found that lncRNA RP11-838N2.4 was down regulated. Considering our previous work, we hypothesis lncRNA RP11-838N2.4 would be account for the TMZ resistance by modulating potential miRNAs in anatomic manner. In this study, we identified biological function of lncRNA RP11-838N2.4 in TMZ resistance. It enhanced TMZ induced cell apoptosis via miR-10a and shed transforming growth factor-β(TGF-β) signaling. Meanwhile, we also demonstrated that lncRNA RP11-838N2.4 expression level was associated with tumor grading and its lower levels showed higher risk of GBM relapse and shorter postoperative survival time.MATERIALS AND METHODSCell cultureHuman GBM cell lines U87 and U251 (gifts from College of Public Health of Southern Medical University, GuangZhou, China) and its TMZ-resistance variant U87TR and U251TR (established and maintained in our laboratory) were incubated at 37℃ in a humidified incubator with an atmosphere of 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% fetal bovine serum (Invitrogen), penicillin (200 units/ml) and streptomycin (100μg/ml). To maintain the TMZ resistance phenotype, U87TR and U251TR were alternately fed with drug-free medium and medium containing 50μg/ml of TMZ.Patients and specimensGBM Patient tissue samples were collected from Zhujiang Hospitals (Southern Medical University, Guangzhou, China) and the stander of Patients enrolled was according the histological diagnosis confirmed. A total of 53 patients were enrolled including thirty-eight GBM cases, three grade III astrocytoma cases, ten grade II astrocytoma cases, two grade I astrocytoma cases, After 6 months temozolomide therapy, twenty-three GBM cases were relapsed. The project protocol was under the approval and guidelines of the Ethics Committee of Zhujiang Hospital and written informed consents were obtained from all of patients enrolled in this study.RNA isolation, reverse transcription, and quantitative real-time PCRTotal RNA from tissues or transfected cells was isolated by using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. The quality and yield of it was examined by the absorbance at 260 and 280 nm. It was only samples with an A260:A280 ratio between 1.8 and 2.1 considered for further analysis. To synthesize cDNA, total RNA was reversely transcribed using prime Script RT reagent Kit (Takala, Dalian, China), miRNAs qPCR Quantitation Kit (Genepharma, Shanghai, China) and respectively according to the manufacturer’s instructions. The primers for miRNAs (miR-10a, miR-10b, miR-125b, miR-21, miR-212-5p, miR-338-3p, miR-567, miR-136-3p) were purchased from RiboBio (Guangzhou, China). Quantitative real-time PCR was carried out in ABI7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) using SYBR Green. According to the manufacturer’s protocol, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 snRNA was used as an endogenous control. All samples were normalized to internal controls and fold changes were calculated through relative quantification (2-△△Ct). The primers sequences were showed in below. seqname Forward primer Reverse primer lncRNA RP11 GTTTCCTGGAAGGGCATTT T TCCAGCTTCTCCTTTTGCA U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT EphA8 GCGCGTCTATGCTGAGATCAA CGGTCCGACTCCAGGTAGT TGFβ1 TACAGCACGGTATGCAAGCC GCAACCGATCTAGCTCACAGAG smad2 CCGACACACCGAGATCCTAAC GAGGTGGCGTTTCTGGAATATA smad4 CTCATGTGATCTATGCCCGTC AGGTGATACAACTCGTTCGTAGT GAPDH TGTGGGCATCAATGGATTTGG ACACCATGTATTCCGGGTCAATWestern blot analysisTotal proteins were extracted from cells using radioimmunoprecipitation assay (RIPA) lysis buffer (Sigma-Aldrich) and quantified by Bicin Choninic Acid (BCA) protein assay kit (Thermo). The Western blot was performed according to standard procedures. The following antibodies were used:EphA8(Cell Signaling Technology, Beverly, MA, USA), TGFβ1(Cell Signaling Technology, Beverly, MA, USA), smad2(Cell Signaling Technology, Beverly, MA, USA), smad4(Cell Signaling Technology, Beverly, MA, USA) and β-actin (Proteintech, USA) were used as loading control. The blots were incubated with goat anti-rabbit or anti-mouse secondary antibodies (Bioss, Beijing, China). The proteins were visualized using a chemilumin escence method (ECL Plus Western Blotting Detection System; Amersham Biosciences, Foster City, CA, USA) and quantifid by ImageJ software The bands were quantified by ImageJ software.Luciferase reporter assayWe cloned the miR-lOa response element (wide type or mutated), contained in the 3’-untranslated regions (3’-UTR) of lncRNA RP11-838N2.4, into target sequence of psiCheck2 plasmid where is downstream of luciferase reporter gene. Using a luciferase assay kit (Promega, Madison, WI, USA), luciferase activities was measured, and target effect was expressed as relative luciferase activity of the reporter vector with target sequence over the one without target sequence. After incubation for 48 hours, the cells were lysed in lx Passive lysis and assayed with the Dual-Luciferase Reporter Assay System (Promega) to measure the Renilla luciferase activity and firefly luciferase served as a transfection control.TMZ chemosensitivity test and IC50 definitionThe GBM cell were plated in 96-well plates at 1×104cells per well after transient transfection or adherence of stable transfected cells. After 24 h, the cells were treated with temozolomide TMZ) (Sigma Chemical Co., St. Louis, MO) concentrations range from 40ug/ml to 640ug/ml for 48 h. The range of drug concentrations were based on earlier studies and aimed at obtaining IC50 values both for highly sensitive and resistant cases. After incubating with 10μl of CCK-8 reagent (Dojindo, Molecular Technologies, Dojindo, Japan) for four hours, the absorbance of cells at 450nm was determined. Then, the spectrophotometric absorbance was measured by using Ultra Multifunctional Microplate Reader (Tecan) at 450 nm. The assay was performed in six replicate wells for each sample and three parallel experiments were conducted simultaneously. IC50 was used to evaluate the resistance of the induced cells. A 50% inhibition in glioma cell activity conduced to the TMZ concentration was defined as IC50.Flow cytometric analysis of apoptosisCell apoptosis after treatment was evaluated using the Annexin V/Propidium Iodide Detection Kit (KeyGEN) according to the manufacturer’s instructions. Cells were then analyzed by FACS cytometry (BD Biosciences Inc.)Cell transfectionCells were transiently transfected with 100 nmol/1 of miR-10a mimics (miR-203), antagomiRs (anti-miR-10a) and miRNA negative control (Genepharma, Shanghai, China) by using Lipofectamine 3000 and OPTI-MEMI (Invitrogen). All of the RNA oligoribonucleotides were purchased from Genepharma (GenePharma, Shanghai, China). Positive transfectants were selected in 500μg/ml Geneticin (G418, Invitrogen). Individual colonies were harvested 24 h later for the evaluation of gene expression or functional assays. The full-length of lncRNA RP11-838N2.4 was synthesized by RiboBio (Guangzhou, China) according to the manufacturer’s instructions.Tumor growth delayAll investigations were approved by the Animal Experimental Committee of Southern Medical University. The male BALB/C nude mice were purchased from Laboratory Animal Center of Southern Medical University, bred and maintained in a specific pathogen-free facility. For xenograft models:1×106 U87TRcell, transfected with pcDNA-RP or pcDNA-NCtrol, were collected and independently injected subcutaneously into the left back and right back of 6 nude mice respectively. Once tumors were palpable, mice were stratified into two treatment groups. Tumors from one group of mice were injected with TMZ 50 ug/ml while the other group was injected with PBS as vehicle control by intraperitoneal injection per every 48h. Mice were anesthetized with 2.5% isoflrane before tumor implantation. Tumor size was monitored routinely for 5 weeks. Mean percent of body weight (±SEM) and tumor size for each group was measured every 7 days.Immunohistochemical analysisImmunohistochemistry for EphA8 was performed on paraffin-embedded GMB or non-tumor samples. Rabbit monoclonal anti-EphA8 antibodies (1:300 dilutions, Abcam) were used as the primary antibodies at 4℃ overnight. Then Specimens were incubated with biotinylated secondary antibody (1:500 dilutions, Santa Cruz Biotechnology, USA) 30 min at room temperature. Then the protein was visualized with diaminobenzidine (DAB) and counter staining was conducted with hematoxylin. Staining intensity was scored manually by two independent pathologists as strong staining=3, moderate staining=2, weak staining=1, no staining=0. PBS was used for substituted of EphA8 antibody as negative control. The final immunohistochemistry (IHC) score of specimens was calculated by multiplying the percentage of positive cells with the intensity score.Terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling (TUNEL)Cells were seeded in 6-well plates and treated with TMZ or PBS for 48 hours. Then, apoptosis was determined by a terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling (TUNEL) (Roche, Mannheim, Germany) assay according manufacturer’s protocol. Cells were observed under a fluorescence microscope (Olympus, Japan). The cells with red nuclei staining were defined as apoptotic cells while the cells with blue staining were defined as nuclear. The apoptotic cells were assessed in 9 randomly selected fields viewed at 200 x magnification.RNA florescent in situ hybridization (RNA-FISH)LncRNA RP11-838N2.4 subcellular localizations in GBM cell was analyzed by use of a FISH kit (Roche Applied Science, Germany). The probe of lncRNA RP11-838N2.4 and lncRNA 18S were synthesized by RiboBio (Guangzhou, China). GBM cell were incubated with 4% paraformaldehyde 10 min at room temperature, then with a digoxin-labeled lncRNA RP11-838N2.4 probe overnight. The lncRNA 18S probe was used as cytoplasm control. Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI). Cells were observed under a fluorescence microscope (Olympus, Japan).Statistical analysisSPSS 20.0 software (SPSS Inc., Chicago, IL, USA) and GraphPad software (GraphPad Software, Inc., La Jolla, CA, USA) were used to analyze all data for statistical significance. The Chi-Square test was applied to the examination of relationship between lncRNA expression levels and clinicopathological characteristics. Two-tailed Student’s t-test was used for comparisons of two independent groups. One-way ANOVA was used to determine the differences between groups for all in vitro analyses. Statistical signifiance was set at*P< 0.05, **P< 0.01. P< 0.05 was considered statistically significant.Result1. LncRNA RP11-838N2.4 was down regulated in TMZ-resistant GBM cells (U87TR and U251TR)Using the parental GBM cell lines U251 and U87, we previously established the TMZ-resistant GBM cell lines U251TR and U87TR. To examine whether U87TR and U251TR have higher resistance to TMZ, CCK-8 was performed to assay cell viability. The result showed that U87TR and U251TR are more capable of growth than their parental cells U87 and U251 after cultured with TMZ 50 ug/ml. Meanwhile, the half maximal inhibitory concentrations (IC50) of TMZ was observed that the U87TR cell (289.53±5.54ug/ml) was 2.95 times higher than U87 cell (98.104±2.63ug/ml) and U251TR (269.57±16.98ug/ml) was 2.46 times higher than U251cell (109.48±1.82 ug/ml). Simultaneously, incubating withTMZ 50 ug/ml 48 hours, the rate of cellular apoptosis was also examined by flow cytometric. The cellular apoptosis rate of the U87+TMZ (20.42%±0.52%) was 3.49 times higher than U87TR+TMZ (5.86%±1.17%) and the data of the U251+TMZ (19.05%±3.04%) was 2.49 times higher than U251TR+TMZ (7.65%±0.87%). These data indicate that TMZ-resistant U251TR and U87TR cells were less sensitive to TMZ than their parent cell lines.To screen lncRNAs potentially involved in TMZ resistance, microarray lncRNAs analysis was performed between U87TR and U87 cells. There are 2691 lncRNAs and 4866 mRNAs distinct expression (fold Change≥2.0 and p-value≤0.05) showed by Unsupervised hierarchical and heat map clustering. LncRNA RP11-838N2.4 (ENST00000581442), located in chr 18:3466247-3478925, is down regulated with 7.65 folds changes (p value=0.0002299) in U87TR compared with U87. we hypothesis lncRNA RP11-838N2.4 is related with TMZ resistance. At last, qRT-PCR showed lncRNA RP11-838N2.4 significant lower in U87TR and U251TR compared with parent GBM cell U87 and U251. All together, these data indicate that lncRNA RP11-838N2.4 was down regulated in TMZ-resistant GBM cells U87TR and U251TR.2. Down regulation of lncRNA RP11-838N2.4 correlates with TMZ resistance and poor patient survival in GBMTo determine the potential clinical correlation between lncRNA RP11-838N2.4 and TMZ resistance in GBM patients, the expression of lncRNA RP11-838N2.4 was detected by qRT-PCR in patient tissues (15 primary GBM and 23 relapsed GBM). We found that the level of lncRNA RP11-838N2.4 in relapsed GBM patients who were administered TMZ for 6 months was lower than that in primary GBM patients without TMZ treatment (p=0.041). There is no significant association between lncRNA RP11-838N2.4 and the patient’s sex or age. However, its expression positively correlated with the tumor grading (WHO I-II vs. WHOIII-IV) (p=0.001). Furthermore, Kaplan-Meier analysis depicted that GMB patients with higher level of lncRNA RP11-838N2.4 survived longer (p=0.032) than patients with lower level. Taken together, our results revealed that down-regulation of lncRNA RP11-838N2.4 correlated with TMZ resistance and poor patient survival in GBM.3. LncRNA RP11-838N2.4 enhance sensitizes of TMZ in U87TR and U251TRTo gain insight into the subcellular localization of LncRNA RP11-838N2.4, its probe was designed and RNA FISH was performed in U87 and U251 cells. These data showed that RP11-838N2.4 was mainly distributed in the cytoplasm of the U87 and U251 cell lines. To ascertain the role of lncRNA RP11-838N2.4 participated in TMZ sensitivity, we constructed 1v-lncRNA RP11-838N2.4. The over expression efficiency was 60.5 fold in U87TR and 31.95 fold in U251TR compared with the non-targeting control. After U87TR and U251TR transfected with pcDNA-RP, a decrease of cell viability was detected via CCK-8 assay incubation with 50 ug/ml TMZ, and IC50 values of TMZ were decreased by 2.15 and 1.43 folds respectively. Apoptosis was measured by flow cytometric analysis with FACS-based Annexin-/FITC double staining in GBM cells under TMZ 0 ug/ml or 50 ug/ml conditions for 48 hours. The results revealed that U87TR and U251TR transfected with pcDNA-RP showed modest higher rate of apoptosis compared with pcDNA-NC under TMZ Oug/ml while this trend was more significant under TMZ 50 ug/ml. Meanwhile, this result detected by TUNEL was similar to flow cytometric analysis. Collectively, the results showed that apoptosis progression was increased following the up regulation of lncRNA RP11-838N2.4 in TMZ-resistant GBM cells U87TR and U251TR.4. LncRNA RP11-838N2.4 enhance TMZ-induced cytotoxicity of U87TR in vivoTo assess the effects of lncRNA RP11-838N2.4 on TMZ-induced cytotoxicity of GBM cells in vivo, U87TR cells transfected with pcDNA-NC or pcDNA-RP were synchronously injected into the flanks of nude mice. A xenograft model was applied to measure the size and mass of implanted tumors with treatment of PBS or TMZ 5μg/g via intraperitoneal injection. No animals died during the course of the treatment and no other complications, such as skin necrosis due to infection, were detected. The results revealed that, with PBS treatment, U87TR cells transfected with pcDNA-RP showed slower tumor growth compared to U87TR transfected with pcDNA-NC, while this trend was more significant under TMZ treatment. After a 5-week inoculation, the average weight of tumors developed from pcDNA-RP-transfected U87TR cells was noticeably smaller than U87TR cells transfected with pcDNA-NC, either with PBS or TMZ treatment. These results suggest that lncRNA RP11-838N2.4 enhances TMZ-induced cytotoxicity of U87TR cells in vivo.5. LncRNA RP11-838N2.4 reduces the expression of miR-10a and relieves its inhibition effect to down-stream targetThe result showed that miR-lOa was the most remarkable down regulated miRNA in U87TR transfected with pcDNA-RP. Subsequently, the expression level of miR-lOa was also significant down regulated in U251TR transfected with pcDNA-RP. After that, it is up regulated in U87TR and U251TR compared with parent GBM cell. Furthermore, there was negative relationship between lncRNA RP11-838N2.4 and miR-10a in GBM tissues, confirmed by qRT(R=-0.375). Secondly, the sequences of lncRNA RP11-838N2.4 was compared with miR-10a seed sites by the online software RNAhybird2.0. Based on this prediction, the wild type sequence of lncRNA RP11-838N2.4 (lncRNA RP11-838N2.4-WT) or its mutant sequence (LncRNA RP11-838N2.4-mut) was sub cloned into the pMIR luciferase reporter and then co-transfected with miR-10a or miR-control into U87TR cells. Luciferase result confirms that lncRNA RP11-838N2.4 could inhibit miR-lOa by contain sequence that can complementary to miR-10a. The relative luciferase activity of the pMIR-LncRNA RP11-838N2.4-WT was significantly decreased, when miR-10a was co-transfected into U87 cells. All together, these data indicate that the up-regulation of lncRNA RP11-838N2.4 reduces miR-10a expression in GBM.To explore if lncRNA RP11-838N2.4 could also relief the repression of miR-lOa to its down-stream target, we randomly choose EphA8 as target. We examined EphA8 expression of U87TR and U251TR cells transfected with miR-10a or miR-control. The qRT-PCR and western blot analysis demonstrated that EphA8 were decreased in U87TR and U251TR cells transfected with miR-10a. As predicted, the expression levels of EphA8 were reversely increased in the U87TR and U251TR cells transfected with miR-10a+pcDNA-RP, compared with the miR-10a+pcDNA-NC, which was detected by qRT-PCR and Western blot analysis. Taken together, these data indicate that lncRNA RP11-838N2.4 could relieve miR-lOa inhibition effect to EphA8.As mentioned above, miR-10a originally soars in TMZ resistance GBM cell lines (U87TR, U251TR), while ascended lncRNA RP11-838N2.4 could reduce the expression of miR-lOa and attenuates its inhibition effect to down-stream target.6. LncRNA RP11-838N2.4 reverses the inhibitory effect of miR-10a on TMZ sensitivity of GBMIn view of the inhibitory effect of lncRNA RP11-838N2.4 on miR-lOa expression and function in GBM, we further investigated whether lncRNA RP11-838N2.4 had the same effect on the TMZ resistance regulated by miR-10a. We first transfected cells (U87TR and U251TR) with miR-10a or anti-miR-10a and examined the cell viability. The CCK-8 analysis demonstrated that cell viability was enhanced in U87 and U251 cells transfected with miR-10a and was decreased in U87TR and U251TR transfected with anti-miR-10a. Similarity, the IC50 value of U87 and U251 transfected with miR-10a was increased while IC50 value of U87TR and U251TR transfected with anti-miR-10a was decreased. These results indicate that miR-10a increase the TMZ resistance that consists with previous study.To confirm LncRNA RP11-838N2.4 enhance TMZ sensitivity via interact with miR-10a in ceRNA mechanism that depend of the conserved motif, U87TR and U251TR that already over expressed miR-10a were transfected with pcDNA-RP-wild, pcDNA-RP-mut or pcDNA-NC. The result showed that compared with miR-lOa+pcDNA-RP-mut and miR-10a+pcDNA-NC, the viability of U87TR and U251TR transfected with miR-lOa+pcDNA-RP-wild was decreased, which was measured by CCK-8. Simultaneously, The IC50 value of U87TR and U251TR transfected with miR-10a+pcDNA-RP-wild was decreased.In cell apoptosis assays by flow cytometric analysis, the apoptosis rate of U87TR and U251TR cells transfected with miR-lOa+pcDNA-RP-wild was increased compared with other two groups which showed the similar results with those of CCK-8 assay. Interestingly, this trend was significantly amplified under treatment of TMZ 50 ug/ml. Similarly, In TUNEL apoptosis assays, the apoptosis rate of U87TR and U251TR cells transfected with miR-lOa+pcDNA-RP-wild were significantly higher than those transfected with miR-lOa+pcDNA-RP-mut and miR-10a+ pcDNA-NC under treatment of TMZ 0 ug/ml while this trend was more significant under TMZ 50 ug/ml.All in together, our data shows that lncRNA RP11-838N2.4 enhance TMZ sensitivity via interact with miR-10a in ceRNA mechanism that depend of the conserved motif.7. LncRNA RP11-838N2.4 sheds the activity of TGF-β signalingThe documents have reported that both miR-10a and TGF-β signaling pathway playing crucial roles in cancer cell EMT, apoptosis as well as TMZ resistance. To further explore the potential mechanism that might link the lncRNA RP11-838N2.4, miR-10a and TGF-P signaling in TMZ resistance of GBM, firstly, we examined the mRNA and protein expression levels of TGFβ1, smad2 and smad4 in TMZ-resistance cell (U87TR, U251TR) transfected with pcDNA-RP or pcDNA-NC. qRT-PCR analysis revealed that the mRNAs expression levels of TGFβ1 and smad2, not smad4, were reduced in the U87TR and U251TR transfected with pcDNA-RP, compared with the pcDNA-NC, besides, the difference expressions were also confirmed in protein levels by Western Blot. Considering up-regulated lncRNA RP11-838N2.4 could alleviate miR-10a inhibited function to its down-stream target, We examined the mRNA and protein expression levels of TGFβ1, smad2 and smad4 in TMZ-resistance cell (U87TR, U251TR) transfected with miR-lOa or miR-control. In surprise, both of mRNA and protein level of TGFβ1, smad2, smad3 and smad4 did not showed significant change.Conclusion1. LncRNA RP11-838N2.4 was negative correlation with glioma cells TMZ resistant and glioma patients with lower lncRNA RP11-838N2.4 expression level, taken the worse prognosis and higher in recurrence risk.2. The lncRNA RP11-838N2.4 exist a complement area to miR-10a "seed". LncRNA RP11-838N2.4 the expression of miR-lOa was reduced and the inhibition of miR-10 to its down target was released.3. LncRNA RP11-838N2.4 can be used as ceRNA involved in regulating TMZ resistance of glioma which relies on the active of miR-10a.To sum up, lncRNA RP11-838N2.4 can be used as ceRNA involved the formation of TMZ resistance in glioma through regulating miR-10a.
Keywords/Search Tags:TNZ, Resistant, Glioma, LncRNA, CeRNA
Related items