Font Size: a A A

Effects Of New RAS Members In Atherosclerosis-related Diseases And The Underlying Mechanisms Exploration

Posted on:2017-05-10Degree:DoctorType:Dissertation
Country:ChinaCandidate:J KongFull Text:PDF
GTID:1224330488451910Subject:Internal medicine (cardiovascular disease)
Abstract/Summary:
1 IntroductionThe renin-angiotensin system (RAS) is an important hormone system that regulates blood pressure and is crucially involved in the regulation of normal physiology and pathogenesis of cardiovascular diseases. Many well-known cardiovascular effects of RAS are attributable to the angiotensin-converting enzyme-angiotensin Ⅱ axis (ACE-Ang Ⅱ axis), and Ang Ⅱ, as the main effector, participates in the processes of many diseases, like hypertension, atherosclerosis, myocardial infarction, pathological myocardial remodeling, heart failure and metablic syndrome. ACE2, a new homologue of ACE, can hydrolyse Ang Ⅱ to yield Ang (1-7), and the ACE2 catalytic efficiency in this process is>400 times for that of ACE for Ang Ⅰ. In addition, ACE2 can convert Ang Ⅰ to Ang (1-9), which is further cleaved by ACE or other enzyme to yield Ang (1-7).To date, many studies have drawn attention to the effect of ACE2 and its product Ang (1-7) on cardiovascular diseases. Previous study has found the abundant expression of ACE2 in atheroselerotic plaques in New Zealand white rabbits, mainly in endothelial cells and foam cells; overexpression of ACE2 could attenuate atheroselerotic lesions, indicating the close association of ACE2 with atheroselerosis. The expression of both ACE2 and ACE were upregulated in rats with acute myocardial infarction, and ACE2 was mainly expressed by vascular endothelium, smooth musle cells, macrophages and myocytes. Myocardial ACE2 level was increased in patients with heart failure, and the overexpression of ACE2 inhibited the development of myocardial fibrosis and ameliorated the diastolic function of the left ventricle in hypertension rats. On the contrary, the absence of ACE2 severely impaired cardiac functions, leading to increased blood pressure, abnormal cardiac contractility and adverse left ventricular remodeling of the postmyocardial infarction. These indicated the improtant role of ACE2 in cardial diseases. Ang (1-7), as the main catalytic product of ACE2, and an endogenic antagonist of Ang Ⅱ, has broad important biological effects, including vasodilatation, pressure depression, inhibition of smooth muscle cell (SMC) proliferation, diuresis, natriuretic effect and suppressing angiogenesis. Therefore, ACE2-Ang (1-7) axis provides negative regulation of RAS, and functions to maintain homeostasis of the caidiovascular system. They may be considered as the new target for the therapy of cardiovascular diseases.The role of ACE2 in cardiovascular function is clearly important, but little is known about its genetic regulatory elements.2 Objectives(1) To indentify the activate domain of ACE2 promoter and the corresponding transcription factors (TF) binding with this promoter and thereby elaborating regulatory mechanism of ACE2.(2) To detect the regulation of ACE2 by TF in vivo, and to study the effect of TF on atheroselerotic lesions and plaque stability.3 Methods3.1 Plasmid ConstructionPGL3-basic luciferase reporter vector was used to detect the active regions of ACE2 promoter. We generated ACE2 promoter-pGL3 constructs with serial deletions of the DNA fragments in the upstream region of ACE2. After PCR amplification, the deleted DNA fragments were cloned into the pGL3-basic vector at the Kpnl and Xhol sites to generate 10 deletion constructs to detect the promoter activity of ACE2. The sequences of these constructs were as follows:-2304 to +48bp,-1799 to +48bp,-1424 to +48bp,-1236 to +48bp,-1021 to +48bp,-800 to +48bp,-553 to +48bp,-353 to +48bp,-163 to +48bp. For a detailed identification of the active region of ACE2 promoter, we generated 3 constructs with serial deletions of the DNA fragments between-353 to-163bp, that is -309 to +48bp,-267 to +48bp,-214 to +48bp.3.2 Cell culture and transfectionHela cells, seeded in 6-well plate with 70% confluence, were transfected with 2μg of plasmid DNA. After the transfection, hela cells were stimulated by AngⅡ(10-7M)for 24hr.3.3 RT-PCRTotal RNA was extracted from transfected hela cells or human smooth muscle cells (hSMCs). The gene expression levels of β-actin, luciferase and ACE2 were quantitatively analyzed by RT-PCR.3.4 Liquid chromatography tandem mass spectrometry (LC-MS/MS) analysisThe DNA fragment sense strand oligonucleotides of human ACE2 promoter (tattctaaaatctgttacatatctgtcctctccaggatgaactttatattg,-214 to-163bp) was labeled with biotin and incubated with nuclear proteins. The DNA-pretein complex was pulled down by streptavidin agarose beads, and then LC-MS/MS analysis was done to detect possible transcription factors binding with the active region of ACE2 promoter.3.5 siRNA transfectionHela cells or hVSMCs got transfection with siRNA of TF to examine their effect on luciferase or ACE2 expression.3.6 Chromatin Immunoprecipitation (ChIP) AssayChIP assay was to detect the binding ability of TF with ACE2 promoter. Sonication was performed to the harvested cells to achieve chromatin fragments, and immunoprecipitation was carried out with antibodies against transcription factors. Then DNA was extracted and PCR was done by use of primers covering the positive region of ACE2 promoter.3.7 Western Blot assayWe extracted total proteins from cultured cells. The expression levels of target proteins were determined by western blot assay.3.8 Co-immunoprecipitation (Co-IP) analysisCo-immunoprecipitation assays were performed in human smooth muscle cells treated with Ang Ⅱ to detect the combination of different TF.3.9 Preparation of Lentiviral vectorsTF-overexpression lentivirus (TF-LV) were transfected into MOVAS with a GFP-LV as the control virus. Western blot was done to detect overexpression effect of TF.3.10 Animal models(1) Seventy-five 8-week-old male ApoE’mice were fed on a high-fat diet for 4 weeks, and then were randomly divided into 4 groups due to various LV transfection by intravenous injection:control group (n=15), mock group(n=30), NKRF group (n=15), C/EBP-(3 group(n=15). At the end of 8 weeks, we provided euthanasia for all the mice.(2) Ninety-five 8-week-old male ApoE-/- mice were fed on a high-fat diet for 2 weeks. We placed a constrictive silastic tube to the right common carotid artery of all the mice to induce a vulnerable atherosclerotic lesion. After 6 weeks of the surgery, animals were divided into 4 groups (n=20 per group for control, NKRF and C/EBP-β, respectivley; n=35 for mock group), and the trearment of each group was the same with the above, but the virus was delivered locally to plaques. At the end of 12 weeks, we provided euthanasia for all the mice.3.11 Body weight and Serum lipid profileAt the very beginning and the end of the in vivo experiment, body weight of all the animals was measured. A commercial enzymatic assay was used for the detectionf of serum levels of total cholesterol, triglycerides, low-density lipoprotein cholesterol and high-density lipoprotein cholesterol.3.12 Histopathological examinationSerial cryosections of the aortic roots and the right carotid arteries were stained by H&E, oil-red O, Sirius red. The sections of the carotid plaques were also stained for immunohistochemical analysis with antibodies of macrophages, SMCs, MMP-2 and MMP-9. The vulnerable index of carotid plaques was calculated.4 Results4.1 Promoter region responsible for ACE2 transcription activityPGL3-basic vectors with serial DNA fragments of ACE2 promoter were transfected into hela cells via lipofectamine, and these cells were subsequently incubated with Ang Ⅱ for 24 hr. The expression of luciferase was measured by RT-PCR. The results showed that the transcription of pGL-163 vector significanlty decreased the expression of luciferase. We furher built three shorter vectors btween -353 to -163bp region, and the detected result of luciferase indicated the active region of ACE2 promoter located in -214 to-163bp.4.2 Identification of transcription factors biding with ACE2 promoterAfter the oligonucleotide-based pull-down procedure and LC-MS/MS analysis, proteins NF-kappa-B-repressing factor (NKRF), HMG box transcription factor (BBX), Zinc finger protein 189, Chromogranin-A (CHGA) and CCAAT/enhancer-binding protein beta (C/EBP-β) may be the possible TF of ACE2. siRNA of the 5 TF and pGL3-214 vector were cotransfected into hela cells, respetively, to detect their effect on luciferase expression; as well, these siRNA were transfected into hSMCs, respetively, to detect their effect on ACE2 expression. The interference of NKRF or C/EBP-β could reduce both the espression of luciferase and ACE2. ChIP assay confirmed the binding of NKRF and C/EBP-β with ACE2 promoter. Co-IP assay incdicated the interaction of the two factors. Therefore, NKRF and C/EBP-β were finally identified as the TF of ACE2.4.2 Basic characteristics of mice in in vivo studyThe body weight and serum lipid levels were not different among groups of the two parts of the in vivo study, respectively.4.4 The effect of NKRF and C/EBP-β overexpression in carotid plaquesWestern blot analysis showed that when compared with control group, NKRF-LV transfection significantly increased the protein levels of both NKRF and C/EBP-β, while C/EBP-β LV transfection markedly increased C/EBP-β expression, but had no effect on the expression of NKRF.4.5 The effect of NKRF and C/EBP-β overexpression on ACE2 levelBoth of the NKRF and C/EBP-β overexpression could upregulate the protein level of ACE2 in carotid plaques.4.6 The effect of NKRF and C/EBP-β overexpression on carotid plaque composition and vulnerabilityCompared with the control group, both of the NKRF and C/EBP-β overexpression could increase the content of SMCs and collagen, while decrease the content of lipid and macrophages in carotid plaques, leading to a reduced plaque vulnerability index.4.7 The effect of NKRF and C/EBP-β overexpression on MMPs levelIn in vivo study, immunostaining assay showed the protein levels of MMP-2 and MMP-9 were lower in NKRF and C/EBP-β groups than that of the control group. Western blot analysis showed that C/EBP-β overexpression obviously decteased the protern levels of both MMP-2 and MMP-9, while C/EBP-β overexpression markedly reduced the expression of MMP-9, with no effec on the expression of MMP-2.In in vitro study, the level of MMP-9 in both NKRF and C/EBP-β groups was obviously lower than that of the control group, while only in C/EBP-β group, the MMP-2 expression was obviously reduced.4.8 The effect of NKRF and C/EBP-β overexpression on inflammatory cytokinesCompared with the control group, the protein expression of MCP-1 and TNF-α were markedly decreased in both NKRF and C/EBP-β group.5 Conclusion(1) The active region of ACE2 promoter was idendified between -214 to -153bp, and NKRF and C/EBP-β combined to regulate ACE2 expression.(2) In ApoE-/- mice models of atherosclerosis, overexpression of NKRF and C/EBP-β could upregulate ACE2 expression, and subsequently increased the plaque stability.(3) The mechanisms of overexpression of NKRF or C/EBP-β increasing the plaque stability also involved the inhibition of the expression of MMP-2, MMP-9 and inflammatory cytokines.1 IntruductionAbdominal aortic aneurysm (AAA) is a chronic vascular degenerative disease mostly occurring in humans over 65 years old. The main characteristic of AAA is the permanent dilation of abdominal aorta. The degradation of extracellular matrix proteins leads to the progressive weakening and dilatation of the vessel, and eventual rupture. Approximately 15 000 persons die from AAA rupture every year, and it has become the 13th leading cause of death in the United States. Although the incidence of AAA increases every year, and it becomes severe life threatening, the mechanisms of AAA formation and progression are not fully elucidated. Currently, the only treatment option for patients with aneurysms is intraluminal or invasive surgical repair when the aneurysm expands past a critical point (usually a diameter threshold of 5 cm). A large number of patients who are asymptomatic, or intolerable of surgery, or with small aortic aneurysms cannot benefit from surgery. Therefore, it is very important to find effective and safety pharmacotherapy to reduce aneurysm expansion and rupture.The main experimental animal model of AAA is induced by chronic infusion of angiotensin Ⅱ (Ang Ⅱ) in ApoE-/- mice, which shows characteristics similar to human AAAs. Ang Ⅱ is the main effector of renin-angiotensin system (RAS), and it leads to chronic inflammation, degradation of extracellular matrix and vascular remodeling. Ang Ⅱ was considered as the end product of RAS, but recent studies has shown that other peptides of RAS also have biological effect. Ang (1-7), which is cleaved from Ang Ⅱ by angiotensin-converting enzyme 2 (ACE2), counteracts the detrimental effects of Ang Ⅱ in cardivascular renal diseases, such as dilating vessels, decreasing blood pressure, inhibiting the proliferation of smooth muscle cells and suppressing vascular neointima formation. Ang (2-8), also known as Ang Ⅲ, is a degradation product of Ang Ⅱ by aminopeptidase A and were reported to share similar effects with Ang Ⅱ on the regulation of blood pressure and renal function.Ang (3-8), also known as Ang Ⅳ, which is hydrolyzed from Ang Ⅱ by dipeptidylaminopeptidase Ⅲ or from Ang Ⅲ by aminopeptidase N, was found to increase blood flow in the central nervous system and contributed to improving learning skill and memory. As well, chronic Ang Ⅳ infusion improved endothelial function in early and advanced atheroma. Thus, Ang Ⅳ appeared to counter-regulate the deleterious effect of Ang Ⅱ. On the other hand, Ang IV showed proinflammatory properties by activating nuclear factor-κB (NF-κB) and upregulating related proinflammatory genes in cultured vascular smooth muscle cells (SMCs), suggesting a harmful effect mimicking Ang Ⅱ.Therefore, the exact role of Ang Ⅳ in vascular diseases remains obscure and the mechanism underlying its contradictive effects is poorly understood. Hereto, the effect of Ang Ⅳ on Ang Ⅱ-induced AAA models has not been reported in the literature. In this study, we sought to explore the therapeutic effects of Ang Ⅳ on Ang Ⅱ-induced AAA in ApoE-/- mice and to elaborate the possible mechanism mediating these effects.2 Objectives(1) To establish animal models of AAA in ApoE-/- mice induced by chronic infusion of Ang Ⅱ.(2) To investigate the effect of Ang Ⅳ at different doses on Ang Ⅱ-induced AAA in ApoE-/- mice.(3) To illustrate the possible molecular mechanism involved in Ang Ⅳ protection against AAA.3 Methods3.1 Establishment of animal modelsThere are three parts of the in vivo study.The first part was to examine the dose-effect of Ang IV on Ang Ⅱ-induced AAA. One hundred male ApoE-/- mice aged 6-8 weeks on a C57BL/6J background were fed on a high-fat diet for 8 weeks. At the 4th week, relevant agent was infused into an osmotic pump respectivley, and the osmotic pump was implanted subcutaneously in each mouse for 28 days. Based on the different agent treatment, mice were randomly divided into 5 groups (n=20 per group). The control group received infusion of saline, the no treatment group received infusion of only Ang Ⅱ (1.44 mg/kg/day), the low-dose Ang Ⅳ group received infusion of Ang Ⅱ (1.44 mg/kg/day) plus Ang Ⅳ (0.72 mg/kg/day), the medium-dose Ang IV group received infusion of Ang Ⅱ (1.44 mg/kg/day) plus Ang Ⅳ (1.44 mg/kg/day), and the high-dose Ang IV group received infusion of Ang Ⅱ (1.44 mg/kg/day) plus Ang Ⅳ (2.88 mg/kg/day). All mice underwent euthanasia after 28-day infusion and the aortic tissues were extracted for further investigation.The second part was to elaborate the role of type 4 Ang receptor (AT4R) in the effect of Ang IV on Ang Ⅱ-induced AAA. Sixty male ApoE-/- mice aged 6-8 weeks on a C57BL/6J background were fed on a high-fat diet for 8 weeks. At the 4th week, relevant agent was infused into an osmotic pump respectivley, and the osmotic pump was implanted subcutaneously in each mouse for 28 days. Based on the different agent treatment, mice were randomly divided into 3 groups after a 4-week high-fat diet feeding (n=20 per group):a no treatment group that received infusion of only Ang Ⅱ(1.44 mg/kg/day), a medium-dose Ang Ⅳ group that received infusion of Ang Ⅱ (1.44 mg/kg/day) plus Ang Ⅳ (1.44 mg/kg/day), a divalinal-Ang Ⅳ group that received infusion of Ang Ⅱ (1.44 mg/kg/day) plus Ang Ⅳ (1.44 mg/kg/day) and AT4R antagonist divalinal-Ang Ⅳ (1.44mg/kg/day). These agents were continuously infused into mice subcutaneously via an osmotic pump for 28 days and then the aortic tissues were extracted from all mice after euthanasia.The third part was to assess the effects of different doses of Ang Ⅳ alone on AAA formation in the absence of Ang Ⅱ. Eighty male ApoE-/- mice aged 6-8 weeks on a C57BL/6J background were fed on a high-fat diet for 8 weeks. At the 4th week, relevant agent was infused into an osmotic pump respectivley, and the osmotic pump was implanted subcutaneously in each mouse for 28 days. Based on the different agent treatment, mice were randomly divided into 4 groups (n=20 per group):the control group, the low-dose Ang Ⅳ group, the medium-dose Ang Ⅳ group and the high-dose Ang Ⅳ group, receiving infusion of saline and different doses of Ang Ⅳ (0.72 mg/kg/day,1.44 mg/kg/day and 2.88 mg/kg/day), respectively, via an osmotic pump for 28 days.3.2Systolic blood pressure measurementA noninvasive tail-cuff system was used for the measurement of systolic blood pressure every week after infusion of the above drugs. Blood pressure was reported as a mean of 3 consecutive measurements.3.3 Tissue histological analysisAt the end of the in vivo experiment, the aortic tissues were extracted from all mice after euthanasia, and the incidence of AAA and the maximal diameter of the abdominal aorta were measured. AAA was defined as≥50% enlargement of the external diameter of the abdominal aorta as compared with the control group. A center section of the AAA,5μm, was prepared for histology and morphology analysis. Aortic sections were routinely stained by hematoxylin and eosin (H&E), Verhoff-Van Gieson (VVG) staining and masson’s trichrome staining.Immunohistochemistry was perfomed involving detection of macrophages (MOMA-2), SMCs (α SM-actin), matrix metalloproteinase 2 (MMP-2), MMP-9 and inflammatory cytokines including monocyte chemoattractant protein-1 (MCP-1), and interleukin-6 (IL-6).3.4 Cell culture and treatmentHuman primary aortic SMCs (hSMCs) from passages 4 to 6 were used.The first part was to examine the dose-effect of Ang IV on Ang ll-stimulated hSMCs. After 24-hr serum starvation, cells seeded in 6-wells with 80% confluence were stimulated with Ang Ⅱ (10-7M), Ang Ⅱ (10-7M)+ Ang Ⅳ (10-9M), Ang Ⅱ (10-7M)+ Ang Ⅳ (10-7M), or Ang Ⅱ (10-7M)+ Ang Ⅳ (10-5M) for 24 hr.The second part was to study the role of Akt signaling in the effect of Ang IV against Ang Ⅱ. Cells seeded in 6-wells with 80% confluence were cultivated with Akt inhibitor A6730 for 1 hr before adding Ang Ⅱ(10-7 mol/L) and Ang IV (10-9 mol/L), and were harvested after a further 24-hr stimulation.3.5 Western blot analysisTotal proteins were extracted from the suprarenal aortas of ApoE-/- mice or hSMCs. Western blot was performed to detect the protein expression of type Ⅰ collagen, type Ⅲ collagen, MMP-2, MMP-9, MCP-1, IL-6, ICAM-1, NF-κB, Akt, p-Akt, AT1R, AT2R and AT4R.3.6 RT-PCRTotal RNA was extracted from the suprarenal aortas of ApoE-/- mice or hSMCs. In both in vivo and in vitro experiments, the mRNA expression of AT1R, AT2R and AT4R was analyzed.3.7 ZymographyAortic protein extracts (30mg) from mice were resolved under a non-reducing condition, and the MMP activity was measured using a MMP gelatin zymography kit.4 Results4.1 Blood pressureAng Ⅱ infusion significantly increased systolic blood pressure (SBP) in ApoE-/- mice compared with saline treatment and baseline. However, neither dose of Ang IV nor divalinal-Ang IV had effect on SBP.4.2 Ang Ⅳ effect on the incidence of AAA in Ang Ⅱ-infused ApoE-/- miceAt the end of the study, the incidence of AAA was 0%,87.5%,66.7%, 37.5%,83.3% in control, no treatment, low-, medium- and high-dose Ang Ⅳ groups, respectively. Compared with no treatment group, medium-dose Ang Ⅳ treatment significantly decreased AAA incidence and the maximal diameter of the abdominal aorta, while there was no obvious difference between high-dose Ang Ⅳ treated group and no treatment group. High-dose Ang Ⅳ treatment reversed the decline of AAA incidence and the decrease of maximal aortic diameter caused by medium-dose Ang Ⅳ treatment.In the absence of Ang Ⅱ stimulation, there was no AAA formed in low-, medium- and high-dose Ang IV alone treatment groups, and the maximal abdominal aortic diameters in ApoE-/- mice of the three groups were not significantly different from that of the control group.4.3 H&E and Verhoff stainingH & E and Verhoff staining revealed that Ang Ⅳ infusion caused vascular remodeling, including breakdown of the aortic media and adventitia, weakening and dilation of the aortic wall, hypertrophy of the adventitia and luminal thrombosis in ApoE-/- mice. Medium-dose Ang Ⅳ treatment could block these pathological changes induced by Ang Ⅱ, with high-dose Ang Ⅳ treatment not showing obvious changes compared with the no treatment group.4.4 Effect of different doses of Ang Ⅳ on cell components of AAA induced by Ang Ⅱ in ApoE-/- miceCompared with the no treatment group, low- and medium-dose Ang Ⅳ treatment could increase SMC content in aortic wall determined by immunohistochemical staining, whereas high-dose Ang Ⅳ treatment showed no obvious effect. In contrast, macrophage infiltration was markedly attenuated in medium-dose Ang Ⅳ treated group compared with no treatment group, with no significant changes in low- or high-dose Ang Ⅳ treated groups. Compared with the medium-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment significantly increased macrophage infiltration, while decreased SMC content in aortic wal.4.5 Effect of different doses of Ang Ⅳ on the expression of extracellular matrix (ECM)-related proteinsMasson’s trichrome staining showed that low-and medium-dose Ang Ⅳ treatment significantly increased collagen deposition in aorta as compared with the no treatment group, while high-dose of Ang Ⅳ had no such effect. Western blot analysis showed compared with no treatment group, low-dose Ang Ⅳ treatment obviously increased type Ⅲ collagen expression in abdominal aorta, and medium-dose Ang Ⅳ treatment significantly increased both type Ⅰ and type Ⅲ collagen expression, whereas high-dose Ang Ⅳ treatment had no such effect. However, high-dose Ang Ⅳ treatment significantly blocked the increaseof type Ⅰ and type Ⅲ collagen expression induced by medium-dose Ang Ⅳ treatment.In in vitro study, low-dose Ang Ⅳ stimulation obviously increased type Ⅰ and type Ⅲ collagen expression, while there was no difference between no treatment and high-dose Ang Ⅳ groups. Compared with the low-dose Ang Ⅳ group, the expression of type Ⅰ and type Ⅲ collagen was obviously decreased in high-dose Ang ⅣV group.In in vivo study, both immunohistochemical staining and western blot assay showed that compared with the no treatment group, the protein levels of MMP-2 and MMP-9 in abdominal aorta were obviously reduced in low-and medium-dose Ang Ⅳ groups, while there was no marked change in high-dose Ang Ⅳ group. Gelatin zymography assay showed that low- and medium-dose Ang Ⅳ treatment significantly decreased the activities of MMP-2 and MMP-9, while high-dose Ang Ⅳ treatment had no such effect. When compared with the medium-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment significantly increased the expression and activity of MMP-2 and MMP-9.In in vitro study, low- and medium-dose Ang Ⅳ treatment significantly decreased MMP-2 expression, while high-dose Ang Ⅳ treatment had no such effect; low-dose Ang Ⅳ treatment also significantly inhibited MMP-9 expression, while medium- and high-dose Ang Ⅳ treatment had no such effect. When compared with the low-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment significantly upregulated the expression of MMP-2 and MMP-9.4.7 Effect of different doses of Ang Ⅳ on the expression of inflammatory cytokinesIn in vivo study, immunostaining staining showed that compared with the no treatment group, the protein levels of MCP-1 and IL-6 in abdominal aorta were obviously reduced in low-and medium-dose Ang Ⅳ groups, while there was no obvious change in high-dose Ang Ⅳ group. The results of western blot assay indicated that the protein expressions of MCP-1, IL-6 and ICAM-1 were significantly lower in medium-dose Ang Ⅳ group than that of no treatment goup; the protein expressions of IL-6 and ICAM-1 were significantly lower in low-dose Ang Ⅳ group than that of no treatment goup, while the expression of MCP-1 shwed no difference; the protein expressions of MCP-1, IL-6 and ICAM-1 were not significantly different in high-dose Ang IV group from that of no treatment goup.In vitro study showed that low-dose Ang Ⅳ stimulation significantly decreased Ang ll-induced upregulation of MCP-1, IL-6 and ICAM-1 in hSMCs, whereas high-dose Ang Ⅳ stimulation had no obvious effect on inflammatory cytokine expressions. When compared with low-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment significantly increased the expression of MCP-1, IL-6 and ICAM-1.a) Effect of different doses of Ang Ⅳ on Akt and NF-κB signalingIn in vivo study, compared with the no treatment group, medium-dose Ang Ⅳ treatment significantly increased the phosphorylation of Akt and suppressed the expression of NF-κB, while whereas high-dose Ang Ⅳ treatment had no obvious effect. When compared with medium-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment significantly decreased the phosphorylation of Akt and upregulated the expression of NF-κB.In in vitro study, phosphorylated Akt production was significantly increased and NF-κB expression was obviously decreased in low-dose Ang Ⅳ treated hSMCs compared with the no treatment group, while there was no difference between hig-dose Ang Ⅳ and no treatment groups. When compared with low-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment significantly reduced the phosphorylated Akt and incresed the expression of NF-κB.Blunted Akt signaling by A6730 eliminated the suppression of inflammation and MMP-2 expression by low-dose Ang Ⅳ treatment, and diminished low-dose Ang Ⅳ-induced upregulation of collagen, while it did not have effect on MMP-9 expression.4.9 Effect of different doses of Ang Ⅳ on the expression of different types of Ang receptorsCompared with the no treatment group, the mRNA of AT1R decreased in the low-dose Ang Ⅳ group, while mRNA levels of AT2R and AT4R showed no difference; the protein expression of AT2R was markedly increased in the low-dose Ang Ⅳ group, while the protein levels of AT1R and AT4R showed no difference. In medium-dose Ang Ⅳ group, mRNA and protein levels of AT2R and AT4R were markedly incresed, while mRNA and protein level of AT1R decreased. In high-dose Ang Ⅳ group, the mRNA levels of AT1R, AT2R and AT4R showed no obvious changes, while the protein level of AT1R was mildly dicreased. When compared with medium-dose Ang Ⅳ group, high-dose Ang Ⅳ treatment induced a significant increase in the mRNA and protein expression of AT1R, while cuased a significant decrease in the mRNA level of AT4R and protein expression of AT2R and AT4R. The in vitro study got similar results.Compared with the medium-dose Ang Ⅳ grou, application of AT4R antagonist divalinal-Ang IV did not significanlty affect the AAA incidence and maximal diameter of abdominal aorta. However, co-treatment with divalinal-Ang Ⅳ significantly reversed medium-dose Ang Ⅳ-induced increase in SMC content and collagen deposition in AAA. As well, it markedly abolished the suppression of inflammation and macrophage infiltration by medium-dose of Ang Ⅳ. Thus, divalinal-Ang Ⅳ could counteract a part of Ang Ⅳ protection against AAA.5 Conclusions(1) Ang IV performed dose-dependent bidirectional effect on Ang ll-induced AAA in ApoE-/- mice, and optimal dose Ang IV treatment could provide benefit for AAA.(2) Mechanisms involved in Ang Ⅳ protection against AAA included the increase of SMCs and collagen content, the decrease of macrophage infiltration, and the supression of the expression and activities of MMPs, as well as the reduction of inflammatory cytokines.(3) Ang Ⅳ could induce the upragulation of AT2R and AT4R and the downregulation of AT1R, and the switched expression of variable Ang receptors mediated the protection of Ang IV against Ang ll-induced AAA.(4) The activation of Akt signaling and inhibition of NF-κB were involved in the molecular menchanism of the beneficial effect of medium-dose Ang Ⅳ on Ang ll-induced AAA.
Keywords/Search Tags:ACE2, atherosclerosis, NKRF, C/EBP-β, plaque vulnerability, Ang Ⅳ, AAA, inflammation, AT4R, divalinal-Ang Ⅳ
Related items