| The neural crest is a provisionality structure in the early development of vertebrate embryos. The neural crest cells have the potential to develop into different types of cells through migration, proliferation, and diferenciation, including enteric nervous cells and melanocytes. The development of the neural crest cells is complicated and regulated by several signaling pathways and genes. Structural variation or change of expression in these genes can lead to development disorder of neural crest cells. Then, the developments of enteric nervous cells and melanocytes are abnormal, resulting in Hirschsprung’s disease(HSCR) and pigment disorder.HSCR is a common genetic intestinal malformation of human or animal, owning to the absence of ganglion cells caused by the migration disorder of neural crest cells during the embryonic development. Because of the absence of ganglion cells, the motion of intestine is abnormal; feces can not be passed and detained in foregut, resulting in megacolon. The pathogenesis of HSCR is complicated, phenotype of which is variable, the main cases of which are isolated, and the do not abided the Mendel’s law. HSCR is known as the result of interactions of several genes. Genetic studies on HSCR can explain a minority of case only and the pathogenesis is not very clear. Therefore, detecting new susceptibility genes or modifer genes or loci for major genes will be significant.Coat color is decided by the type and quantity of melanin produced by melanocytes. Development disorder of melanocytes not only results in pigment disorder, but also is considered to be associated with many human diseases, such as melanomas and Parkinson’s disease. The development of melanocytes is complex and regulated by several signaling pathways and transcription factors. But up to now, mechanisms of regulation are not clear enough.In this study, two stains of HSCR rats(AGH-Ednrbsl and LEH-Ednrbsl) with different phenotype were used to generate F1 and F2 descendants. Genome-wide QTL mapping for HSCR and pigment disorder was performed using the F2-Ednrbsl/sl rats; then bioinformatics analysis was used for screening of HSCR and pigment disorder candidate genes; genetic difference between AGH and LEH strains of the candidate genes was detected by sequencing; effect of the genetic difference was assessed through several bio-techniques: vector construction, cell culture, dual luciferase report gene assay system. In order to identified the interaction between two genes modifying the phenotypes of HSCR and pigment disorder, gene knock out cells were constructed and genome-editing via oviductal nucleic acids delivery system based on CRISPR/Cas9 and electroporation technologies were performed. The main results of this study were listed as follow:(1) The aganglionosis of AGH-Ednrbsl/sl rats was more serious than that of LEH-Ednrbsl/sl rats. The aganglionosis of F1-Ednrbsl/sl rats was relieved compared to AGH-Ednrbsl/sl rats. These results indicated that modifier loci or genes in the genetic background of LEH rats interacted with Ednrb to modify the phenotype of HSCR.(2) A significant QTL was detected on Chr 2 around D2Mgh14 marker for HSCR in rats. The highest LRS score was 25.0, which explained 15% of the total variation. The LEH allele resisted the HSCR. The phenotype of AGH homozygote was the most serious, followed by AGH/LEH heterozygote and LEH homozygote.(3) Three candidate genes(Slc45a2, Gdnf and Ptger4) were detected within the 95% confidence interval of QTLs for HSCR on Chromosome(Chr) 2. A mutation(g.76896910 C>T) was identified in the 613 bp upstream of the first initiation codon of Gene gene, the base of which in LEH rat is “C” and that of AGH is “T”. The result of dual luciferase report gene assay system showed that this mutation reduced the transcriptional activity of Gene promoter dramatically in AGH rat. This result indicated that Gdnf might interate with Ednrb to affect the phenotype of HSCR.(4) The head of AGH-Ednrbsl/sl rat was white almost, whereas the head of LEH-Ednrbsl/sl rat showed pigment partially. The pigment disorder of F1-Ednrbsl/sl rats was relieved compared to AGH-Ednrbsl/sl rats, suggesting that modifier locus(loci) or gene(s) within the genetic background of LEH stain interacted with Ednrb to affect the phenotype of pigment disorder.(5) A highly significant QTL was detected on Chr 7 for pigment disorder, the highest LRS of which was 45.0 in D7Got23 locus explaining 26% variations of pigment disorder. In this locus, AGH homozygote rats showed the most serious pigment disorder, whereas the LEH homozygote or AGH/LEH heterozygote rats showed a comparable serious pigment disorder. The D7Got23 locus interacted with the D3Rat78 locus and D14Mit4 locus to affect the phenotype of pigment disorder. The LEH allele on D7Got23 or D3Rat78 locus resisted pigment disorder. While the AGH allele on D14Mit4 locus resisted pigment disorder.(6) Three candidate genes(Lgr5, Wif1 and Kitlg) were detection within the confidence interval of QTL for pigment disorder on Chr 7. A synteny analysis in other mammals revealed that this QTL corresponded comparatively to a region on Chr 10 in mouse, which housed Kitlg interacting with Ednrb to modifier the expressivity of a white forelock and dorsal hypopigmentation. A missense mutation(g.42338824 C>T) was detected on the coding region of Kitlg, which resulted in an amino acid substitutions from praline to serine. The prediction result of SITF on line showed the mutation might affect the function of protein. These results indicated the interaction between Kitlg and Ednrb might account for the difference of coat color between AGH-Ednrbsl/sl rats and LEH-Ednrbsl/sl rats.(7) gRNAs for knocking out Ednrb or Gdnf gene of rat or mouse were obtained based on CRISPR/Cas9: 1)Rat-Ednrb-gRNA:GAGCCGGTGCGGACGCGCCT;2)Rat-Gdnf-gRNA:CGCTTCGAGAAGCGTCTTAC;3)Mouse-Ednrb-gRNA:GAGCCGGTGCGGACGCGCC-T;4)Mouse-Gdnf-gRNA:GTCTACGGAGACCGGATCCG. Ednrb and Gdnf knockout rat C6 cell lines were established. These results will provide materials for further study on the interaction of Ednrb and Gdnf in vitro and obtaining Ednrb and Gdnf knockout mice.(8) The CRISPR/Cas9 and eGFP mRNA was obtained based on in vitro transcription. The eGFP mRNA was tested to be activated using HEK293 T. Delivery of tetramethylrhodamine-labelled dextran into 1.5 d embryo of mice was viable, the condiction of which was: 110 v of voltage, 5 ms of pulse width, 50 ms of pulse interval, and 3 of number of pulses. The rate of normal embryo with tetramethylrhodamine-labelled dextran was 27%. Larger or lower voltage would reduce the rate dramatically. These results will provide theory and technology for obtaining Gdnf and Ednrb, and Kitlg and Ednrb knockout mice to study the interaction of two genes influencing the development of enteric ganglion cells and melanocyte in vivo. |
PDF Full Text Request