| Background:Hepatocellular carcinoma(HCC) is one of the most common malignancies all over the world. HCC is mainly derived from hepatic cirrhosis induced by chronic injury. Fibrosis destroys hepatic blood vessel and rapidly proliferative tumor cells consume overmuch oxygen, which contribute to the hypoxic microenvironment of HCC.Hypoxia is one of the major hallmarks of HCC, which involves in the initiation and progression of HCC. HIF-1 is a major factor response to hypoxia and consists of oxygen-dependent HIF-1α and oxygen-independent HIF-1β. Under hypoxia condition, stabilized HIF-1α translocates to nuclear and binds to HIF-1β. HIF-1α and HIF-1β form HIF-1 heterodimer, which binds to the promotor of hypoxia response genes(HRGs) and regulates their transcription. HIF-1 involves in HCC initiation, angiogenesis, metastasis, and resistance to chemotherapy and radiotherapy.NF-κB signal pathway is also activated in hypoxic cells. NF-κB is a series of dimer transcription factors consists of different subunits, including p65(Rel A), RelB, c-Rel, NF-κB1(p105/p50) and NF-κB2(p100/p52). NF-κB is involved in regulating cell survival and immune response, cancer initiation and development, and plays important roles in HCC progression. Activated NF-κB in HCC enhances the secretion of inflammatory cytokines such as IL-6 and IL-1β, which create an inflammatory environment to promote HCC progression.The interaction between HIF-1 and NF-κB may play an important role in hypoxia response. In published researches, NF-κB subunits p50 and p65 bind to the promotor of HIF-1α and promote its’ transcription; HIF-1α also regulates NF-κB activation. However, above researches did not investigate the full-scale and dynamic interaction between HIF-1 and NF-κB. Better understanding of the interaction and mechanisms between HIF-1 and NF-κB in hypoxic hepatocarcinoma cells may provide new strategies for HCC prevention and treatment. Objective:To investigate the interaction between HIF-1 and NF-κB in hypoxic hepatocellular carcinoma cells, and uncover the underlying molecular mechanisms. Materials and Methods:1. Human HepG2 and Huh7 hepatocellular carcinoma cell lines were exposed under hypoxia(1% O2) for 0-24 h in vitro, HIF-1α, HIF-1β, p50, p65 and c-Rel expression were monitored by q PCR and Western Blot.2. Vista was employed to predict the binding site for p50, p65, c-Rel on the promotor of HIF-1α and chromatin immunoprecipitation(ChIP) assay was used to confirm the prediction in HepG2 and Huh7 cells. HepG2 cells were transfected with shNC, shp65, shc-Rel, mock, p65, c-Rel lentivirus separately and these cells were treated under hypoxic condition for 4h and 24 h, HIF-1α expression was assessed by qPCR and Western Blot.3. Targetscan 6.2 and mi RGene 2.0 were used to predict the upstream mi RNAs of HIF-1α and downstream mi RNAs of c-Rel separately, overlaped and screened the candidate mi RNAs. The temporal expression of candidate miRNAs in hypoxic Hep G2 cells were monitored by qPCR. ShNC, shc-Rel HepG2 cells were exposed to hypoxic condition for 0h, 4h, 24 h, candidate mi RNA expression were detected by q PCR. Candidate mi RNA overexpressing Hep G2 cells were exposed to hypoxic condition for 4h, HIF-1α expression was assessed by qPCR and Western Blot. Luciferase assay was used to assess the binding potential of mi RNA and HIF1 A 3’UTR.4. The expression of mi RNA biosynthesis enzyme Dicer1 in hypoxic hepatocarcinoma cells was monitored by Western blot, HepG2 cells were transfected with sh NC, sh Dicer1 letivirus and these cells were exposed to hypoxic condition for 0h, 4h, 24 h, mi R-93 and mi R-199a-5p expression were detected by qPCR.5.shNC and sh Dicer1 HepG2 cells were exposed under hypoxia for 0h, 4h, 24 h, HIF-1α expression was monitored by qPCR and Western Blot.6. Vista was employed to predict the binding site for HIF-1, p50, p65 and c-Rel on the promotor of Dicer1, the prediction was then confirmed by chromatin immunoprecipitation(Ch IP) assay in HepG2 and Huh7 cells. Vista was also used to predict the HIF-1 binding site the promotor of p50, p65 and c-Rel. Hep G2 cells were transfected with sh NC, shHIF1 A lentivirus, these cells were exposed under hypoxia for 0h, 4h, 24 h, then the expression of p50, p65, c-Rel, Dicer1, mi R-93, mi R-199a-5p was assessed. Results:1. The m RNA and protein levels of NF-κB subunits p50, p65 and c-Rel increased in a time-dependent manner under hypoxia for 0-24h; the m RNA level of HIF-1α also increased in a time-dependent manner under hypoxia, while the protein level of HIF-1α increased under short-term hypoxia(0-4h) but decreased under prolonged hypoxia(4-24h).(1) The m RNA levels of HIF-1α and NF-κB subunits p50, p65, c-Rel in Hep G2 and Huh7 cells increased in a time-dependent manner under hypoxia(0-24h), while the mRNA level of HIF-1β in Hep G2 and Huh7 cells was almost invariable.(2) The protein levels of p50, p65 and c-Rel in HepG2 and Huh7 cells increased in a time-dependent manner under hypoxia(0-24h), the protein level of HIF-1β was alomost unaltered; the protein level of HIF-1α increased under short-term hypoxia(0-4h) but decreased under prolonged hypoxia(4-24h).2. NF-κB subunits p50 and p65 directly bound to the promotor of HIF-1α and promoted HIF-1α expression; c-Rel inhibited HIF-1α expression in an indirect manner under prolonged hypoxia(4-24h).(1) There was no binding site for NF-κB subunit c-Rel on the promotor of HIF-1α, but there were binding sites for p50 and p65, S1(chr14: 62162387-62162397, sequence: AGGGGTTTCCC) was the mutual binding site for both p50 and p65, while S2(chr14: 62162718-62162728, sequence: CCGGGCTCCCC) was the particular binding site for p65.(2) Deficiency of p65 significantly reduced m RNA and protein levels of HIF-1α in Hep G2 cells exposed to hypoxia for 4h, but this effect was not shared with c-Rel deficiency; deficiency of p65 also significantly reduced mRNA and protein levels of HIF-1α in HepG2 cells exposed to hypoxia for 24 h, deficiency of c-Rel did not affect HIF-1α m RNA level, but elevated HIF-1α protein level in Hep G2 cells exposed to hypoxia for 24 h.(3) p65 overexpression remarkably elevated m RNA and protein levels of HIF-1α in Hep G2 cells exposed under hypoxia for 4h and 24 h, while c-Rel overexpression significantly reduced mRNA and protein levels of HIF-1α.3. NF-κB subunit c-Rel downstream mi R-199a-5p and mi R-93 directly bound to HIF1 A 3’UTR and inhibited HIF-1α expression post-transcriptionally.(1) Overlapped HIF1 A 3’UTR upstream miRNAs and c-Rel downstream miRNAs, six candidate miRNAs were identified: miR-199a-5p, miR-18 a, miR-20 a, miR-93, miR-17 and miR-106 b. Among them, miR-17 level in HepG2 cells increased in a time-dependent manner under hypoxia, the levels of miR-199a-5p, miR-93 and miR-106 b decreased under short-term hypoxia(0-4h) but increased under prolonged hypoxia(4-24h). miR-20 a level decreased under hypoxia during 0-2h but increased during 3-24 h. miR-18 a level decreased under hypoxia during 0-8h and 12-24 h, but increased under hypoxia during 8-12 h.(2) c-Rel deficiency reduced the levels of mi R-199a-5p, mi R-18 a, mi R-20 a, miR-93, mi R-17 in Hep G2 cells under hypoxia for 0h, 4h, 24 h, but did not affect the level of mi R-106 b.(3) mi R-93, miR-199a-5p overexpression remarkably reduced HIF-1α m RNA and protein expression in Hep G2 cells exposed to hypoxia for 4h, mi R-18 a overexpression reduced HIF-1α protein level rather than HIF-1α mRNA level, mi R-17 overexpression did not affect the levels of HIF-1α m RNA and protein.(4) Both mi R-93 and miR-199a-5p significantly reduced the luciferase activity of HIF-1A 3’UTR, the effect was not shared with mi R-17 and mi R-18 a.4. The level of Dicer1 decreased under short-term hypoxia(0-4h), but increased under prolonged hypoxia(4-24h); Dicer1 positively regulated mi R-93 and mi R-199a-5p expression.(1) Protein level of Dicer1 in Hep G2 cells decreased under short-term hypoxia(0-4h), but significantly increased under prolonged hypoxia(4-24h).(2) Dicer1 deficiency significantly reduced miR-93 and mi R-199a-5p expression in Hep G2 cells under both normoxia and hypoxia.5. Dicer1 negatively regulate HIF-1α expression, and this mechanism mainly worked under prolonged hypoxia(4-24h).Dicer1 deficiency did not affect HIF-1α mRNA and protein expression in HepG2 cells under normoxia or hypoxia for 4h, but remarkably elevated HIF-1α m RNA and protein expression under hypoxia for 24 h.6. HIF-1 bound to the promotors of p50, p65, c-Rel, Dicer1 and enhanced their expression, further induced mi R-93 and mi R-199a-5p up-regulation.(1) There was no binding site for p50, p65 and c-Rel on Dicer1 promotor, while there was a binding site for HIF-1 on Dicer1 promotor, namely chr14: 95623615-95623634(sequence: CGGCGCGCGCGTCACAGCCC).(2) There were binding sites for HIF-1 on the promotor of p50, p65 and c-Rel, namely Chr4: 103423385-103423404(sequence: GCAGAAGTGCTTGTCAGTCC) site on p50 promotor, Chr11: 65430400-65430419(sequence: CCGCCGTCGCGTCACTGCCC) site on the promotor of p65, and Chr2: 61109146-61109165(sequence: CAGGGTTTGCGTGCAGAATC) site on the promotor of c-Rel.(3) HIF-1α deficiency significantly reduced m RNA levels of p50, p65, c-Rel, Dicer1, mi R-93, mi R-199a-5p in HepG2 cells under hypoxia for 4h and 24 h, and HIF-1α deficiency also remarkably reduced protein levels of p50, p65, c-Rel and Dicer1 in Hep G2 cells under hypoxia for 4h and 24 h.Conclusions:1. The sharp increase of HIF-1 during the short-term hypoxia(0-4h) contributes to the elevation of NF-κB sububits p50, p65, c-Rel and mi RNA biosynthesis enzyme Dicer1 in hepatocarcinoma cells, p50 and p65 feedforward enhance HIF-1α transcription.2. The up-regulated c-Rel and Dicer1 during short-term hypoxia phase(0-4h) promotes downstream mi R-199a-5p and miR-93 expression in hepatocarcinoma cells, which contribute to post-transcriptional repression of HIF-1α by targeting its 3’UTRs during prolonged hypoxia phase(4-24h). |
PDF Full Text Request