Font Size: a A A

Folate Deficiency Induces Hypomethylation And Resultant Overexpression Of DR4Together With Altering DNMTs In Alzheimer’s Disease

Posted on:2015-10-01Degree:DoctorType:Dissertation
Country:ChinaCandidate:Y WangFull Text:PDF
GTID:1224330467965971Subject:Neurology
Abstract/Summary:
BackgroudAlzheimer’s disease (AD) is a debilitating neurodegenerative disease, which brings heavy burden for the society. The pathology of AD is senile plaques and neurofibrillary tangles, combined with massive neuronal loss, mainly in the hippocampus and association regions of the neocortex. AD has complex etiology and pathogenesis. Its cause is not clear yet but known to encompass many genetic and environmental risk factors, inflammation, oxidative stress, energy metabolism, changes in the expression of many genes, and up regulation of multiple pathogenic pathways such as amyloid β peptide (Aβ) deposition, tau hyperphosphorylation, and aberrant cell cycle control/apoptosis.The majority of cases of AD are sporadic, and likely several genetic and environmental factors contribute to their development. Reversible epigenetic alteration is expected to be a potential mechanism for explaining unsolved phenomena beyond genetic association with sporadic AD. Studies have established a link between epigenetic changes and AD pathogenesis. One of the most studied epigenetic modifications is the change of methylation patterns of CpG rich regions in the promoters of specific genes, which modifies gene expression by interfering the binding between DNA and transcription factors, and then results in gene silencing (hypermethylation) or overexpression (hypomethylation).Folate metabolism, also known as one-carbon metabolism, is required for the production of S-adenosylmethionine (SAM), which is the major DNA methylating agent. Studies have indicated that folate values were reduced in the plasma of AD individuals. Impaired folate metabolism and subsequent reduction of SAM levels might result in epigenetic modifications of the promoters of AD-related genes leading to increased A peptide production. Studies performed in mice and in neuronal cellβ cultures indicated that the depletion of folate, respectively from the diet or from the media, resulted in epigenetic modifications of AD-related genes, with a subsequent increased production of Presenilin1(PS1), beta-site APP-cleaving enzyme1(BACE1), and Aβ fragments.DNA methyltransferase (Dnmt)1, the enzyme maintenancing DNA methylation, and Dnmt3a, who initiates DNA methylation de novo, coregulated the methylation status of genes. DNMT1and components of the methyl-CpG binding protein2/methyl-CpG binding domain protein (MECP2/MBD2) methylation complex were significantly reduced in the entorhinal cortex of AD subjects than in controls. DNMT1,3a and3b were differently modulated, in response to hypomethylating (folate and B vitamin deficiency) and hypermethylating (S-adenosyl-L-methionine supplementation) alterations of the one-carbon metabolism in AD models, in line with the changes of PS1methylation pattern.Efforts were made to determine aging-and AD-related genome-wide methylation pattern or module. Actually, some researchers have chosen peripheral blood as their research material, and the gene methylation pattern of peripheral blood has been successfully addressed. It should be noted that lymphocytes may be an important neural and genetic probe in AD-related studies.Death receptors4(DR4), also known as tumor necrosis factor superfamily, member10(TNFSF10A), is activated by tumor necrosis factor-related apoptosis inducing ligand,(TRAIL) and thus transduces cell death signal and induces cell apoptosis. DR4has been shown to mediate oligomeric Ap-induced cerebral microvascular endothelial cell apoptosis. Aberrant promoter methylation and resultant silencing of DR4were reported in cancers, strongly attenuating TRAIL-or DR4-mediated apoptosis in cancers. An inverse association between cancer and AD has been found. One possible explaination for this association is that both diseases arise via malfunction of an underlying common mechanism, which could regulate the capability of the cells of switching the cell machinery from a prone-to-death state (AD phenotype) to a prone-to-survive/grow state (cancer phenotype). Genetic polymorphisms or variance in their DNA methylation could explain such opposing effects. To date little is known about the relevance of this epigenetic modification in AD. This work was to evaluate the patterns of gene expression and promoter methylation of DR4from peripheral circulating blood lmphocytes of AD patients and folate-deficiency medium cultured neuroblast cells, and also expression levels of DNMT1, DNMT3a, and MECP2.MethodsCell CultureHuman SH-SY5Y neuroblastoma cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) without folate, supplemented with folate with different final folate concentrations (normal DMEM contains folate with concentrations as4ug/ml), complemented with1xNon Essential amino acids,1mM Sodium Pyruvate,1.5g/L Sodium bicarbonate, and10%fetal bovine serum and incubated in5%CO2at37℃. Cultures were re-fed every second day. All assays were repeated at least three times.Patients and controlsAll procedures were done in accordance with the Declaration of Helsinki and approved by the institutional reviewing board. A written consent form was obtained from every participant signed by self or caregiver. Sporadic AD patients were diagnosed and recruited based on the American Psychiatric Association "Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, the diagnostic criteria of the DSM-IV-R" standards for dementia and National Institute of Neurological and Communicative Diseases and Stroke; Alzheimer Disease and Related Disorders Association, NINCDS-ADRDA diagnostic criteria for likely AD.Inclusion criteria:1) more than60-year-old men or postmenopausal women;2) meet the DSM-IV-R diagnosis standards of dementia;3) meet the NINCDS-ADRDA diagnostic criteria for possible or likely AD;4) no family history of AD or other genetic disease;5) the subjects or their caregivers voluntarily agreed to participate in the trial and signed the informed consent form.Exclusion criteria:1) not greater than60years of age;2) the family history of dementia or other genetic diseases;3) patients with Hamilton Depression Scale (HAMD)≥15with obvious symptoms of depression or Hachinski Ischemic score≥7with vascular dementia;4) patients suffering from other diseases or their control siblings suffering from other diseases;5) the patients or their families do not agree to participate. The controls were same age, same sex, and non-dementia healthy subjects,(see table1for detailed information). Mini-Mental State Examination (MMSE) was caculated and fasting blood samples were intravenously drawn.Cell viability assayCell viability of SH-SY5Y cells was evaluated by the3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) assay. MTT was purchased from Sigma. Briefly, cells after incubation for specified times were plated in96-well plates containing different mediums (supplemented with folate concentration0ug/ml,1ug/ml,4ug/ml,8ug/ml, and16ug/ml, respectively) and incubated for24h, and10μl of the MTT solution (5mg/mL) was added to each well and went on with incubation for4hour at37℃in incubator. After removing the supernatant, the cells were added with100uL DMSO each well for shaking for15min on a microtiter plate shaker. The absorbance was measured at570nm using a microplate reader. All experiments were repeated3times. The viability ratio was calculated as follow:viability%=(ODnegitive-ODsample)/(ODcontrol-ODblank)×100%.Hoechst33258stainingCell cultures were stopped after144h for Hoechst33258staining. Cells were collected and fixed, and then stained with0.5ml Hoechst33258. And then we examined the nuclei of the cells with fluorescence microscopy.Bisulfite sequencing PCRCell cultures were stopped after144h for methylation assays. Genomic DNA from blood lymphocytes and SH-SY5Y cells were extracted using Qiagen DNeasy Blood&Tissue Kit according to manufacturer’s instruction. DNA was modified with bisulfate and purified with kit from Sangon Biotech.We got the gene sequence in the Ensembl database online. The CpG islands of the promoter of DR4,600bp upstream of transcription start site, were predicted with the MethPrimer software online, with the indexes set as, criteria used:island size>100, GC Percent>50.0, Obs/Exp>0.6. Two CpG islands were found in the promoter sequence. Island1is from155bp to334bp with the size of180bp, including9CpG sites. And Island2is from360bp to541bp with the size of182bp with13CpG sites (Fig1A&B). Target sequences including these two islands were sequenced.The sequences were PCR amplified with gene-specific primer pairs (F: TATTTAGGAGGTTGAGGTAGGA; R:AACTAACCCTAAACTTCCTTCC, Product435bp) using bisulfite-treated genomic DNA as templates.PCR products were cleared and cloned into PUCm-T vector and sequenced with M13primers. Five clones of each sample were sequenced.Transcription factor binding sites searchingThe TFSEARCH:Searching Transcription Factor Binding Sites (ver1.3) software online (http://www.cbrc.jp/research/db/TFSEARCH.html) was used to search transcription factor binding sites in the target fragments including the CpG sites, searching highly correlated sequence fragments versus TFMATRIX transcription factor binding site profile database. The threshold was set as80.0pointReverse transcription and quantitative real-time PCR (qRT-PCR)Cell cultures were stopped after168h for gene expression analyses. Total RNA from blood samples and cells were purified with RNeasy Mini Kit. Reverse transcription (RT) was performed in a total volume of20μL using PrimeScriptTM RT reagent Kit With gDNA Eraser. The expression levels of DR4, DNMT1, DNMT3a and MECP2were analyzed by quantitative real-time PCR on an ABI Prism7500HT sequence detection system. Each reaction contained5μL of the2xSYBR(?) Premix Ex TaqTM ⅡExtracelluar Aβ40concentrationsCell cultures were stopped after168h for extracelluar Aβ40concentrations analyses. Add50μL of the Standard Diluent Buffer to the zero standard wells. Add50μL of Aβ peptide standards, controls, and samples to each well. Add50μL of Hu Aβ40Detection Antibody solution to each well except for the chromogen blanks. After incubation, add100μL Anti-Rabbit IgG HRP Working Solution to each well, then100μL of Stabilized Chromogen was added. Read the absorbance of each well at450nm having blanked the plate reader against a chromogen blank composed of100μL each of Stabilized Chromogen and Stop Solution. Use a curve fitting software to generate the standard curve. A four parameter algorithm provides the best standard curve fit. Read the concentrations for unknown samples and controls from the standard curve.Folate concentration of blood samplesSerum was separated from each blood sample immediately after drawn, and serum folate concentration was measured by photochemical method on automated chemiluminescence immunoassay system.Statistical analysisThe data were analyzed using the SPSS statistical package (SPSS, version13.0). Paired t-test was used to compare the clinical data to identify sites with statistically significant difference between AD patients and paired normal controls. For the data of cultured cells, t-test was used. Values presented are means±se. P-value was required to be≤0.05to be considered significant. Asterisks in figures evidence the statistically significant differences; differences lacking of remarks are to be considered non-significantResultsFolate deficiency inhibits the growth of SH-SY5Y cellsWe examined the effect of folate deficiency on the viability of SH-SY5Y cells by MTT assay, and we observed both folate deficiency and folate overdose inhibited the growth of SH-SY5Y cells. Cell viability was significantly decreased cultured in medium added with folate0ug/ml,1ug/ml, and16ug/ml for144h than that in medium with folate4ug/ml, and cell growth was remarkably inhibited in medium added with folate0ug/ml after treatment for144h. It is suggested that both folate deficiency and overdose inhibit cell growth as compared with the control, and folate deficiency induced inhibition of cell growth is time-dependently.So we set cells cultured in medium with folate concentration0ug/ml as folate-deficiency group (folate-), and4ug/ml as normal group for next methylation assays (cultured after144h) and gene expression analyses (cultured after168h).Folate deficiency induces apoptosis of SH-SY5Y cellsThe cells cultured with normal medium mostly had round and regular nuclei with Hochest stain, while folate-deficient cultured cells showed more condensation and fragmentation of nuclei. This showed that folate deficiency could induce apoptosis of SH-SY5Y cells.DNA hypomethylation of the promoter of DR4in folate-deficient cultured cellsTwo CpG islands located between-445to-266bp (numbered from the first base of exon1) and-240to-59bp upstream of transcription start site of the promoter of DR4were analyzed, and there were9CpG sites in CpG island1, and13sites in CpG island2. Total methylation rate was48.33±1.97%in folate deficient cells and73.94±3.49%in normal controls (p<0.05). The first CpG island was methylated in samples with a methylation rate of88.89±3.39%in folate deficient cells and82.96±5.19%in normal controls (p>0.05), while the second CpG island with a methylation rate of24.10±6.55%in folate deficient cells and63.59±5.19%in normal controls (p<0.05).Analysis of methylation status of each CpG site evidences some important differences in spatial methylation pattern in DR4promoter. The methylation rates of the6th CpG site of the first island, and also the8th,9th,10th and13th CpG sites of the second island were lower in the folate deficient cells than those in normal cells (p<0.05).And then we used the TFSEARCH software online to search transcription factor binding sites in those fragments including those CpG sites respectively. We found that the fragment including the8th,9th and10th CpG site of the second island was the binding sites of transcription factor GATA1, GATA2, v-yes-1Yamaguchi sarcoma viral oncogene homolog pseudogene (SYR), upstream transcription factor (USF), v-myb avian myeloblastosis viral oncogene homolog (v-Myb) and v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (N-myc), and the fragment including the13th CpG site of the second island was the binding sites of celluar E26transformation-specific (c-Ets), and Ether-a-go-go-like potassium1(Elkl).DNA hypomethylation of the promoter of DR4in AD PatientsBlood plasma samples from25AD patients and25age-and sex-matched elderly normal controls were collected. The mean age was75.44±9.10years, and the male-to-female ratio was1:1.8in both groups. Time since diagnosis of AD patients3.11±2.36years. MMSE was8.64±4.71in AD patients and28.9±1.26in normal controls (p<0.05).The methylation rate was lower in AD patients than that in normal controls (0.87q0.30%vs.2.18±0.41%, p<0.05) in total CpG sites, and it was also lower in the first CpG island (methylation rate2.04±0.71%in AD patients and4.44±0.93%in normal controls, p<0.05). However, no significant difference of methylation rate was found in the second CpG island (0.13±0.12%vs.0.62±0.25%,p>0.05).Analysis of methylation status of each CpG site evidences that he methylation rates of the1st CpG site of the first island, and also the1st and13th CpG site of the second island were lower in AD patients than those in normal controls (p<0.05).And TFSEARCH software showed that the fragment including the1st CpG site of the second island was nearby the binding sites of transcription factor Lymphoid transcription factor1(Lyfl), and13th CpG site was nearby the binding sites of c-Ets, and Elkl.Overexpression of DR4in folate-deficient cultured cells and AD patients by qRT-PCRGene expression analyses by qRT-PCR evidenced the overexpression of DR4in AD patients and folate-deficiency cells. Fig.5A shows DR4expression in human SH-SY5Y cells cultured in different conditions, DR4expression level significantly increased in folate deficient cells comparing to that of normal controls (p<0.01). The expression level of DR4in AD patients was about1.5folds higher than that of controls (p<0.05). Folate concentration in AD patients was8.92±1.12ng/ml, and14.09±1.11ng/ml in controls (p<0.01).DNMT1and DNMT3a were upregulated in folate-deficient cutured cells and AD patientsWe used qRT-PCR analyses to quantify the expression levels of genes that encode DNMT1,. DNMT3a, and MECP2. Expressions of DNMT1and DNMT3a both increased in cells cultured with folate deficient medium and also in AD patients (p<0.05); while expression of MECP2showed no differences neither in cells cultured with folate deficient medium, nor in AD patients (p>0.05).Elevated extracelluar Aβ40concentrations in folate-deficient cutured cellsWe used ELISA analyses to quantify the concentrations of extracelluar Aβ40, and we found that Aβ40concentrations were elevated in folate-deficient cutured cells(p<0.05).ConclusionReversible epigenetic alteration is expected to be a potential mechanism for explaining unsolved phenomena beyond genetic association with sporadic AD. Our presented results showed that DNA methylation levels of DR4in AD blood samples and also cells cultured with folate-deficient medium changed in a site-specific manner. The hypomethylation and upregulated expression of DR4, together with decreased folate concentration and elevated DNMTs expression levels, exacerbate the process of neurodegeneration in AD.
Keywords/Search Tags:Alzheimer’s Disease, DNA methylation, DR4, apoptosis, DNMT
Related items