Font Size: a A A

Ultrasound Targeted Cationic Microbubbles Destruction Combined With The NFκB Nuclear Location Motif For The Treatment Of Myocardial Infarction By Increasing SDF-1α Gene Transfection

Posted on:2015-07-25Degree:DoctorType:Dissertation
Country:ChinaCandidate:Q DengFull Text:PDF
GTID:1224330428975317Subject:Internal Medicine
Abstract/Summary:
Myocardial infarction is irreversible necrosis due to coronary occlusion and myocardial ischemia, which has become an important threat to people’s health. In China millions of people died of myocardial infarction and complications every year. Though the development of coronary revascularization such as timely thrombolysis, PCI and CABG made the mortality of acute myocardial infarction a certain degree of decline, quite a number of patients missed timely treatment window or with multi-vessel coronary lesions can not receive effective clinical treatments.Recent research suggests that the infarcted myocardium can release stromal cell derived factor1α (SDF-1α), which plays the role of stem cells mobilization and induce stem/progenitor cells migrate to the damaged heart tissue. The homing of stem/progenitor cells in the damaged tissue will differentiate into myocardial or vascular cells and release many endocrine factors which will improve the microenvironment of the infarction area, inhibit cell apoptosis and promote tissue repair.Despite this finding is encouraging, the reality is regrettable. Because the body release a limited number of stem cells mobilization agent and the maintaining time is short, so the repair ability is very poor. Which makes it cannot compensate the loss of myocardial cells and the ventricular remodeling caused by myocardial infarction. So this study intends to use SDF-la gene transfect myocardial and increase the expression of SDF-la. The high expression of SDF-la would induce more homing of stem cells and repair infarcted myocardium. It would provide a new way for the stem cell therapy of coronary heart disease. Constructing effective gene delivery system and increasing gene transfection efficiency is prerequisite for high expression of SDF-1α gene.Previous studies have shown that there are at least three problems need to be resolved for the effective expression of exogenous gene:(1) The exogenous gene can escape from the immune system and remove to the target cells;(2) The cell membrane is a main barrier for exogenous gene, gene must get through the cell membrane;(3) The nuclear membrane is another main barrier, gene must successfully get into nucleus through the nuclear membrane. The nuclear membrane is a barrier for exogenous gene transduction and the nuclear import is a highly restrictive process. The nuclear import process is energy dependent. Small molecules such as ion can passively diffuse into the nucleus, but large molecules such as plasmid DNA need the help of nuclear input signal.Based on the three obstacles above, we designed a new gene transfer system to help SDF-la gene transfection in this study.(1) Cationic micro bubbles were used as gene carrier to increase the gene carry efficiency and protect gene from the clear of immune system, which made gene can successfully reach the target cells;(2) Ultrasound targeted microbubble destruction (UTMD) technology was used to make the SDF-la gene targetly release in myocardial tissue, at the same time the biological effect of UTMD can help exogenous genes get through the cell membrane into cytoplasm;(3) The NF kappa B nuclear location motif was used to help the SDF-la gene in the cytoplasm breakthrough the nuclear membrane barrier and get into the cell nucleus for gene replication and subsequent expression. The gene transfection efficiency was improved by increasing the cytoplasmic and nuclear import efficiency. Because more SDF-la was released into the blood so the stem cell homing increased and the curative effect of myocardial infarction was improved.Part1Construction of recombination eukaryotic expression vector phSDF-la-NFKBObjective: We constructed and extract the eukaryotic expression plasmid: phSDF-la-NFxB. The phSDF-la plasmid contained the recombinant human stromal cell-derived factor1α (SDF-1α) gene and the phSDF-1α-NFκB plasmid was constructed by inserting the nuclear factor κB (NFκB) binding motif into the phSDF-la plasmid.Method: Total mRNA was acquired from human fibroblasts and RT-PCRwas used to obtain the hSDF-la DNA. pcDNA3.1(-) vectors were cut using Nhel/EcoRI restriction enzymes, and the RT-PCR products were inserted into the same restriction sites using T4-DNA ligase. The NFκB binding motif:5’-CTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGG GACTTTCCAGCTGGGGACTTTCCAGCT-3’was added to the hSDF-la primers. The hSDF-la-NFKB DNA was obtained as described above. After being digested using BamHI/HindⅢ restriction enzymes, the hSDF-1α-NFκB DNA was cloned into the same restriction site of the pcDNA3.1(-) vector using T4-DNA ligase.All ligation products were transformed into E.coli strain DH5a for amplification and identified using gene sequencing. The correct plasmid was isolated and purified using Endo Free Plasmid Kit.Result: The recombinated eukaryotic expression plasmid phSDF-la and phSDF-la-NFκB were constructed correctly and the open reading frames were confirmed through restrictional enzyme map analysis and DNA sequencing.Conclusion: By gene recombinant technology, recombinant human SDF-1α gene and the NFκB nuclear location motif can be cloned into pcDNA3.1vector to construct the recombinant eukaryotic expression plasmid phSDF-1α-NFκBPart2Ultrasound microbubbles combined with the NFκB nuclear location motif increase SDF-la gene transfection efficiency by enhancing the cytoplasmic and nuclear import of plasmid DNA in vitroObjective: Cytoplasmic and nuclear membrane barriers are responsible for the inefficiency of the non-viral gene transfection because they restrict the import of exogenous genes. We tried to improve the transfection efficiency using a novel gene delivery system, which consisted of two components: ultrasound microbubbles and the NFκB nuclear location motif. Ultrasound-targeted microbubble destruction (UTMD) was used to enhance the cytoplasmic import of plasmids and the NFκB binding motif was added to promote the nuclear intake of the plasmid from the cytoplasm.Methods:In our study, human umbilical vein endo the lial cells were transfected using UTMD with two kinds of Cy3labeled plasmids: phSDF-la and phSDF-1α-NFκB. phSDF-1α-NFκB was constructed by inserting the binding motif for the inducible transcription factor NFκB into phSDF-la. Flow cytometry was used to evaluate the cellular import efficiency of Cy3labeled plasmid under UTMD condition or non UTMD condition. Fluorescence microscopy was used to observe the nuclear location of Cy3labeled plasmid and compare the nuclear import efficiency of phSDF-la-NFκB and phSDF-la. RT-PCR, Western Blot and ELISA were used to detect the expression of SDF-la in gene and protein level. Then we explored the effect of UTMD and NFκB nuclear location motif on gene transfection.Results: UTMD significantly increased the cytoplasmic intake of pDNA(81%±7%) and maintained high cell viability (86%±6%). The nuclear import efficiency of phSDF-la-NFκB was significantly higher than those of phSDF-la (72%±12%VS14%±5%, P<0.01). The SDF-1α protein amount in phSDF-1α-NFiκB and phSDF-1α transfection group was (63±10) ng and (15±5) ng per mg protein. Compared with the NFκB-free plasmids, the amount of NFκB plasmids in the nucleus increased4-fold and the expression of SDF-la protein was about3-fold greater.Conclusion:UTMD combined with NFκB nuclear location motif can significantly improve transfection efficiency by enhancing the cytoplasmic and nuclear import of exogenous plasmid DNA.Part3Ultrasound microbubbles combined with the NFκB nuclear location motif increase SDF-la gene transfection efficiency and improve myocardial infarction curative effectObjective: To increase stem cell homing and improve myocardial infarction curative effect by using ultrasound targeted cationic microbubbles destruction(UTMD) and NFκB nuclear location motif to increase SDF-la gene transfection efficiency.Methods: The rabbit myocardial infarction models were constructed and divided into three groups for gene transfection therapy. Group A were transfected with UTMD+NFκB nuclear location motif+SDF-1α gene; Group B were transfected with UTMD+SDF-la gene; Group C were transfected with SDF-la gene. Echocardiography was used one day after myocardial infarction and one month after gene transfection. Two-imensional echocardiography was used to detect the left ventricular wall motion and cardiac function and the myocardial contrast echocardiography was used to detect myocardial perfusion of all rabbits in the three groups. Three days after gene transfection, three rabbit hearts from each group were obtained to detect the SDF-la gene transfection efficiency by RT-PCR, Western Blot and ELISA. One month after gene transfection, immunohistochemical strain of CD31and CD34were used to evaluate the stem cell homing effect and the FⅧ immunohistochemical strain was used to evaluate the angiogenesis effect. Masson’s trichromatic staining was used to evaluate the degree of myocardial fibrosis and the scar area. Gene transfection efficiency and the curative effect of all the three groups were evaluated and compared.Results:One day after myocardial infarction, the left ventricular anterior wall motion and the left vntricular ejection fraction of three groups were significantly decreased, myocardial contrast echocardiography showed anterior wall myocardial filling defect, there was no obvious difference among the three groups (P>0.05). One month after gene transfection cardiac function was mildly increased in group A, mildly reduced in group B and significantly worse in group C. Myocardial contrast echocardiography showed much contrast filling in the infarction and surrounding area in group A, a little contrast filling in group B and filling defect in group C. There was significant difference among the three groups. For further two group comparison, group A was better than group B and group B was better than group C (P<0.01). Three days after gene transfection, RT-PCR showed the SDF-la mRNA in group A was2.5fold of group B and6fold of group C. Western Blot showed that the SDF-la protein expression trends in the three groups was consistent with the RT-PCR result. ELISA showed the SDF-la protein expression in group A, group B and group C was (233±64) pg,(125±55) pg and (57±48) pg per mg protein. SDF-la protein in group A was2fold of group B and4fold of group C. The immunohistochemical strain of CD31and CD34in group A was higher than that of group B and group C. FⅧimmunohistochemical strain showed that there was much more capillaries in group A, litter capillaries in group B and no obvious new blood vessels in group C. The vascular density in group A, group B and group C was46.4±6.8,21.7±5.4and4.1±1.8per view. Masson’s trichromatic staining showed that the myocardial fibrosis and the scar area were reduced in group A than that of group B and group C.The gene transfection efficiency of group A was significant higher than that of group B and group C. Just as the gene transfection efficiency, the stem cell homing effect and angiogenesis effect of group A were also greater than that of group B and group C.Conclusion:UTMD and NFκB nuclear location motif could promote angiogenesis and improve myocardial function of infarcted heart by increasing SDF-la gene transfection efficiency and stem cell homing.
Keywords/Search Tags:ultrasound-microbubbles, NFκB, SDF-1α, myocardial infarction
Related items
Combination Of Tetramethylpyrazine And Ultrasound Microbubbles Mediate EPCS To Rat Myocardial Infarction
Combination Of Ultrasound Microbubbles And Tat Peptide Enhanced HGF Gene Transfection To Treat Acute Myocardial Infarction
Therapeutic Efficacy Of Ultrasound And Microbubbles For Coronary No-reflow In Patients With Acute Myocardial Infarction
Combination Of Ultrasound Microbubbles And Recombinant Asenovirus AD-EGFP/HIF-1Α Mediate EPCS To Rat Myocardial Infarction
Transplantation Of Bm-mscs After Microenvironment Changes Induced By Ultrasound Targeted Microbubble Destruction Promote Angiogenesis In A Myocardial Infarction Canine Model
The Efficacy Of MSCs Implantation By Diagnostic Ultrasound Mediated Microbubbles Destruction On The Improvement Of Cardiac Function At The Late Time Of Rats Myocardial Infarction
Enhancement Of Ultrasound Targeted Microbubbles Destruction Mediated Angiogenesis With Nuclear Localization Signal Petide In Canine Myocardial Infarction
Myocardium-targeted Transplantation Of Bone Marrow-derived Endothelial Progenitor Cells In Infarcted Myocardium Of Rat Mediated By Diagnostic Ultrasound And Microbubbles
The Combination Of Intracoronary Injection And Ultrasound Targeted Microbubble Destruction(UTMD)Promote The NLS-Ang1 Gene Transfection For Enhancing The Angiogenesis Effect In Canine After Acute Myocardial Infarction
10 Targeted Gene Therapy Using Targeted Cationic Microbubbles Conjugated With Cd105 Antibody Compared With Untargeted Cationic And Neutral Microbubbles