The Studies Of Novel Gene Mutation And Antigen Analysis For HBV In Blood Screening Of Pre-transfusion

Background and ObjectivesBlood transfusion is an important means to save lives. It is very important to perform a series of biological screening before blood transfusion to make sure blood safety. At present, in our country, the Provincial blood centers and blood stations are using enzyme linked immunosorbent assay (ELISA) for detection of pathogenic microorganisms and their components in blood. With the increasing sensitivity of ELISA kit, spreading risk by blood transfusion is becoming relatively lower. However, due to a viral infection" window period" of blood donation, mutation of the virus and immune-silence phenomenon, virus sero-positive blood donors of missed detection problem is still existed, transfusion of blood or blood products transmitted virus still have some residual risk. So, the usage of blood products transfusion related infection is must to be detected. The safety of blood transfusion is becoming very important points. Therefore, to find the more sensitive and specific method for eliminating positive-undetected, to establish a more perfect mode for blood screening, to enhance the safety of blood products transfusion have important practical significance.Hepatitis B is kind of serious disease caused by infection with the hepatitis B virus (HBV). At present, in our country, population infection rate is as high as10%-60%. HBsAg negative occult HBV infection is prevalent in our country. HBV infection can cause liver cirrhosis and liver cancer, is seriously harm to the health of the body and life safety. Therefore, the detection of hepatitis B antigen and its nucleic acid components in blood safety screening before transfusion become the main target.ELISA is using for monitoring HBsAg impost extensive detection method, but its sensitivity is lower, with some operation error, false positive or false negative because of the technique using enzyme catalytic chromogenic substrate method, bring uncertainty to blood safety. At present, in our country, blood center is using double detection by two person through ELISA assay for detection of HBV for reducing the error method, but this method only increased the time of tests, could reduce the operator’s experimental error, but could not avoid the methodology error, e.g. repeated sampling and washing plate, and the plate wells differences, coefficient of variation arising from the larger intrinsic error.In recent years, nucleic acid detection technology (NAT) in blood pretransfusion screening application is highly concerned. The NAT is the directly detection of pathogen nucleic acid. The basic steps include nucleic acid extraction, amplification and detection. NAT is with high sensitivity, can detect trace nucleic acid in sample in a few days after viral infection, which can greatly shorten the" window period". Although NAT theoretically does not completely eliminate infection" window period", but the virus nucleic acid positive before blood infectious is extremely low, can effectively prevent the transfusion transmitted viral diseases. It is said that nucleic acid detection is the last barrier to ensure blood safety. Therefore, the application of NAT can make the transfusion transmitted disease risk to a minimum, so it is expected that NAT will become a new blood screening technology for infectious disease detection.Occult HBV infection that serum HBsAg-negative HBV infection of HBV-DNA positive performance continued at a low level replication status for viral load. Transfusion recipient can get HBV by infected with OBI, its infection rates relatives with the prevalence of HBV infection and genotypes. HBsAg-negative occult HBV infection prevalent in our country is about3%in the normal. In a single anti-HBc-positive people, the serum DNA positive of HBV is about30%-35%, forming the basis of occult hepatitis B virus infection.There are a variety of possible causes of occult HBV infection. The "a" epitope at aa124～147is the major immune dominant epitope of HBsAg, and also is the primary target for existing HBsAg detection reagent. HBsAg mutation is the most important for HBsAg reagent undetection. There are many reports on the "a" epitope and the surrounding hydrophilic regions MHR, aa100～160amino acid mutations cause obviously change of HBsAg antigen activity. Since the "a" epitope is also the main target major protective epitope of hepatitis B vaccine, and hepatitis B immune globulin, the popularity of the "a" epitope of mutant may cause the effectiveness of the existing hepatitis B vaccine and diagnostic reagents, HBsAg "a" epitope analysis is particularly important public health significance.This thesis based on Provincial blood center, selected a large number of samples, using NAT gene mutation detection and chemiluminescence technology joint detection, analyzed Hepatitis B Virus nucleic acid, antigen, antibody in unpaid blood donors, and compared with the traditional ELISA methods. DNA sequence analysis and confirmation of antibody protein typing for negative HBsAg enzyme-linked immunosorbent assay with DNA testing positive serum samples were selected to explore the relationship between serum HBsAg negative mode with HBV DNA, to look for the window period and occult HBV infection. The gene mutation of virus strains was found in occult HBV infection. Than, the virus strains of "a" epitope regions was sequenced, analyzed for the amino acid mutations in the "a" epitope. This thesis is aimed at understanding of HBV occult infection and the prevalence of HBsAg mutant in HBV screening system under the blood donors, to set up a more sensitive, accurate, and consistent with international standards requirements blood screening new model before transfusion, and calculate the residual risk of transfusion-transmitted infectious diseases based on screening results. In addition, the article also discussed the effect of hepatoma cells PI3K/PKB signal transduction pathway to inhibitor of apoptosis protein Survivin, aimed to provide experimental evidence for diagnosis and treatment of liver cancer.Part One The Construction and application of new mode for HBV nucleic acid detection in large-scale screening before transfusionResearch methods 1.The establishment of NAT lab system:In accordance with the Ministry of Health issued the" Interim Measures for the management of clinical gene amplification laboratory", established an standard nucleic acid testing laboratory. All NAT detection was done in this laboratory.2. Sample processing:using anticoagulant blood plasma or serum, after centrifugation, supernatant is used for nucleic acid detection. Samples was collected and stored under4℃, tested within24hours.3. Establish a sample collection-pretreatment-save-the use of standardized processes. Specimen is centrifuged, bar code is read automatically by the automatic pipetting instrument and pipetting to generate a sample file, sent to a laboratory corresponding sample data directory server, automatic ELISA analyzer and nucleic acid detector processing their test results data, corresponding detection data is sent to a lab server directory, LIS processes corresponding sample data and test results data to generate the corresponding test items for each specimen test results and releases to the BIS. Synchronization by deep-well plates to store sample to avoid the risk of errors of human error, and the traditional braided blood storing sample together with the management of information technology to replace the manual save to ensure the reduction of the blood test results.4. ELISA method to detect the corresponding antigen or antibody:Using a double antigen sandwich method or the double antibody sandwich method to detect the corresponding antigen or antibody. The measured absorbance was read at450/630nm value. Threshold established in accordance with the reagent instructions. The detecting A value greater than the critical value is determined to the reactive or non-reactive. ELISA operation in strict accordance with these instructions, core antibody detection diluted1:30with saline.5Standard NAT test automation process was established:the initial stage of the experiment using semi-automated equipment testing, a reagent preparation, and sample’s nucleic acid extraction to the detection of the entire process. The final formation of automatic sample collection, detection standard is finished for process automation. Support bar code scanning, the testing process can be monitored. 6. NAT:Elected mixing examining mode to detect nucleic acid. All samples were selected from that hepatitis B surface antigen negative, HCV antibody negative, HIV antibody negative samples detected with ELISA. Screening assay for combined detection, sample combination coefficient is6. When combined with the detection collection pool samples HBV DNA, HCV RNA, HIV DNA, any one is positive, the pooled sample pool split detection; pick out the corresponding single positive samples. Combined detection method is carrying on at the same time to meet the single samples in clinical detection sensitivity requirements.7. The methodological evaluation of NAT system:To assess the effectiveness of the test results under the Ministry of Health rummage center and international blood screening standard. When the deviation of the test results appear, immediately stop the test, to identify the reasons before proceeding, to ensure that the experimental results are accurate and effective. The system is continuously detecting nearly30,000samples for effective assessment of the overall performance and stability of the experiment.3.8Inspection and confirmation:All ELISA non-reactive, NAT reactive specimens were sent to the Chinese Ministry of Health rummage Center for HBV DNA, HCV RNA and HIV RNA quantitative detection. And blood donors were followed up in order to observe whether the antibody detection window period specimens.3.9Statistical analysis:SPSS10.0software was used for analysis of variance, Student’s test to determine significant differences, P<0.05is significant.The research results1. The NAT detection mode and process design:constructed the patterns and processes of NAT large-scale screening for the detection of hepatitis B virus.2. NAT detection statistics:Among93613donating blood specimens detected by ELISA for HBsAg, anti HCV, anti HIV-1/2, there were total91271for all negative or only one kinds of reagents were negative;91271donating blood specimens were detected by NAT,60cases of positive samples was found, the positive rate was0.066%. 3. Quantitative detection for NAT reactive specimens:NAT breakdown identification test reactivity rate was63.33%(38/60). HBV is the main transmitted disease virus in enzyme immunoassay reagents negative while nucleic acid reagents positive blood donors specimens, different from the HIV as a mainly popular mode in foreign country.4. The viral content distribution of HBV DNA positive samples:In38cases of HBV DNA positive samples, virus content<20IU/ml specimens is28cases, accounting for73.68%;20～100IU/ml specimens is of4patients, account for10.53%.5. The result of HBV detection for single reagent detected:38samples in HBV reactive,16cases was tested by reagents made in China,22cases was tested by reagents made in Abbott reagents; NAT to confirm the reactivity of the two cases is for the U.S. Abbott reagents single reagent detection.15cases of HIV single reagent reactivity, reagents nine cases were used by Made in China,6cases were used by French Bio-Rad reagent;1cases detected reactive by NAT was from French Bio-Rad reagent6. System indicators:Blood screening for nucleic acid detection system of single detection sensitivity was95%, specificity was95%, and single detection limit is50IU/ml, the detection rate of more than95%.Part Two The analysis of serological mode and mutation of HBsAg in sample of HBV ELISA-/NAT+Research Methods1. HBV DNA extraction:extracted the virus DNA from serum samples by the QIAamp MinElute viral nucleic acid extraction kit.2. PCR amplification:The target fragment was amplified using the Prime STAR high-fidelity DNA polymerase in the Bio-Rad IC-Cycler gradient PCR thermal cycler or PE2400PCR amplification. Primer HBSSWF:AACATCAGGATTCCTAGGAC; HBSSWR:CCTTGTAAGTTGGCGAGAA; HBSS-F: TTCATCCTGCTGCTATGCC; HBSS-R:ACGTTTGGTTTTATTAGGGTTC. Amplification product contains HBV pre-S and S region gene. Add5×Prime STARTM Buffer (Mg2+plus)10μl, dNTP Mixture (2.5mM)4μl, Primer1(10μM)1μl, Primer2(10μM)1μl, the extracted template DNA2～4μl, Prime STARTM HS DNA Polymerase (2.5U/μl)0.5μl, sterile distilled water add to50μl. PCR reaction conditions were95℃denaturation for2min.94℃denaturation for30s,56℃annealing for30s and extension at72℃for55s,40cycles. At72℃for2min. Reaction system:10×buffer1.0μl, primer F1.0μl, primer R1.0μl, dNTP1.0μl, Taq0.4μl, ddH2O3.6μl, cDNA2.0μl. Each round of PCR located negative and positive control, the different HBV standard plasmid copy number as a positive control, a sensitivity of50copies/ml. The PCR product was taken2μl observation using2%agarose gel electrophoresis.3. PCR product purification:Made1.5%agarose gel by TBE buffer, and then subjected to agarose gel electrophoresis for the analysis of DNA, SYBR Green I was added in the loading solution. If large amount of amplification products obtained, then electrophoresis was done after amplification in50μl system, if small amount of amplification products, then100μl system was used. The amplified product was purified using a gel purification kit for amplification product Lots specimens (electrophoresis bands of light).4. DNA sequencing:PCR product was cloned, plasmid extraction, bidirectional sequencing using the Big Dye sequencing reaction kit on the ABI PRISM3730type automatic DNA sequencing instrument.5. HBV genotype and sequence analysis:Sequencing and Phylogenetic Analysis: amplification positive PCR product, identified as carrying the HBV genotype.6. Bioinformatics software processing:sequencing results using ContigExpress, MEGA4, and bioinformatics software for analysis and processing. The measured gene fragment sequences with the genotype reference sequence homology Blast lined comparative analysis of gene mutation.The results1. HBV pre-S/S gene PCR amplification:of56specimens,41specimens PCR amplification poor, only15specimens PCR products can be observed in the1400bp specific bands. The most of specimen’s amplification obtained a small amount of product, the specific bands weaker.2. Occult HBV infection in unpaid donors and genotype analysis:23cases ELISA HBsAg positive samples and15cases of occult HBV specimens was amplified by nested PCR positive test genotype, the results show, C genotype in the occult HBV proportion (80.0%) was significantly higher than the proportion of HBsAg positive samples (17.4%), p<0.05.3. Occult HBV infection surface antigen S gene mutation analysis:S sequence analysis to three genotype B and12genotype C. Six cases has the gene sequence point mutations in this region, including3cases of a base point mutations occurred,3cases of two base point mutations occurred.12patients with HBV genotype C,4cases point mutation, while the other three cases of HBV genotype B,2cases of gene mutants.4. HBV S gene "a" decision point mutations in the cluster analysis:15cases of HBsAg ELISA-NAT+specimens sequencing results showed "a" decision cluster has more point mutations, there are nine sites at the "a" determinant within in six specimens, A-C mutation is common.Part Three HBsAg ELISA-/NAT+donors HBV Ab/Ag recognition and analysisResearch methods1. The design and building of Follow-up strategies and follow-up process to HBsAg ELISA-/NAT+donors.2. Specimen collection and handling3. The ECLIA method to detect HBV antibody and antigen4. NAT5. Statistical analysisThe research results1. The design and building of Follow-up strategies and follow-up process to HBsAg ELISA-/NAT+donors.2. The follow-up results of ELISA-/NAT+blood donors The HBV antibody confirmation of HBsAg ELISA-/NAT+blood donors:test "two pairs of semi detection" to59cases of nucleic acid testing positive blood samples, the results show, which one HBsAg positive,43HBcAb positive,26people for HBsAb positive,13positive for HBcAb single.3. HBV window period specimens trace detection profile on unpaid blood donors.4. The recognition of HBV antibody to HBsAg ELISA-/NAT+blood donors.5. The association studies between Anti-HBc expression and occult hepatitis B infection:there are certain correlation between anti-HBc and occult HBV infection, anti-HBc not only can be used as the flag of previous HBV infection, but also can prompt the possibility of occult HBV infection.Part Four The study of survivin expression and regulation in Hepatoma cells Research Methods1. Cell culture:Hepatoma cell lines (Bel-7402) were cultured, the DMEM medium containing10%fetal calf serum, passed every2-3days. According to the literature and the result of preliminary experiments, Bel-7402cells cultured with different concentrations of bFGF or Wortmannin treatment at different times.2. Cell treatment:the number of growing cells1×105/ml were seeded in culture flasks, to be up to70%confluence replaced with serum-free DMEM culture medium, incubated overnight, the cell synchronization, and then treat the cell to the point in time and concentration grouping.3. Western blot analysis:Add appropriate amount of sample suspension buffer to sample, sonication, the centrifugal supernatant, Coomassie-blue method for the determination of protein concentration.10%SDS-PAGE electrophoresis, the PAGE gel, proteins were transferred to nitrocellulose membrane. Join an anti-(PKB Ser473) by Western Blot, developing photo scanning, analysis and processing.4. RT-PCR method to detect the expression of survivin in Bel-7402cells. Extraction of total RNA, design survivin-specific primers, RT-PCR, PCR products were2%gel electrophoresis gel imager observations and photographed.4. Cell cycle analysis:Collect adherent cells, digested by adding70%cold ethanol fixation48h. PI staining. The fluorescence intensity was measured by flow cytometry. Use CellQuest analysis software for DNA content analysis of cell cycle.The results1. PKB activity increased by bFGF processed in Bel-7402.2. Survivin mRNA upregulation after bFGF treatment in Bel-7402.3. PI3K inhibitor wortmannin can inhibit bFGF role of survivin mRNA expression in Bel-7402.4. Wortmannin promotes apoptosis, inhibition of proliferation in Bel-7402.Conclusion1. Hepatitis B virus screening before blood transfusion, the model of the seizure of the blood samples using ELISA technology, NAT technology for re-examination, can precise qualitative and quantitative detection of specimens, and have greater detection rate to window period specimens and occult hepatitis specimens2. Conventional blood screening for detection of HBsAg negative qualified blood, there is still missed the window period and occult hepatitis B infection. C-type virus strains in occult hepatitis B is in common and mutant B virus trains less but higher mutant. The mutant train is able to evade the existing diagnostic reagent.3. Anti-HBc related to occult infection, Anti-HBc not only as a sign of previous HBV infection, but also can prompt the testing rate of occult HBV infection in blood screening. Anti-HBc may not only as a sign of previous HBV infection, can be carried out in areas that do no carry out the nucleic acid detection, to reduced risk of blood transfusion.4. bFGF regulating Survivin transcriptional activity by relying PI3K/PKB ways to promote its expression, thereby inhibiting apoptosis of hepatoma cells, but Wortmannin can inhibit this role and led to the down-regulation of the expression of Survivin. Points of Innovation1. Based Provincial Blood Center, selected a large sample, comparatively to study the existing detection technology about enzyme immunoassay and nucleic acid detection in blood screening before transfusion and transfusion residual risk after transfusion.2. Successfully build a new type of transfusion blood detection mode:compared the enzyme-linked immunosorbent screening technology with nucleic acid detection technology to screen via blood transfusion viral to replace the current single immunological detection methods. It can significantly reduce the risk of transmission through blood.3. Rich the domestic HBV genotype distribution data understand the northern region family of HBV infection HBV gene type distribution, as well as to determine the progression of the disease and prognosis, suggesting that the antiviral efficacy theory that the northern region of HBV infected with HBV gene type distribution the basis be of great significance.4. Anti-HBc and HBV occult infection are relative, anti-HBc may not only as a sign of previous HBV infection, but can prompt the possibility of OBI, anti-HBc, in the areas do not have to carry out of nucleic acid detection, can be able to carry out anti-HBc to reduce the risk of disease transmission.5. The initial recognition bFGF stimulation Bel-7402cells, regulating Survivin transcriptional activity by relying PI3K/PKB ways to promote its expression, thereby inhibiting apoptosis of hepatoma cells.