Font Size: a A A

Effect And Its Mechanism Of α-Synuclein Knockdown On Dopaminergic Neurons In Parkinson's Disease In Vitro Model

Posted on:2010-10-18Degree:DoctorType:Dissertation
Country:ChinaCandidate:F X WuFull Text:PDF
GTID:1114360302983769Subject:Human Anatomy and Embryology
Abstract/Summary:
Parkinson's disease (PD) is named after Dr. James Parkinson, who provided a detailed description of this disorder in 1817. The clinical symptoms of PD include resting tremor, rigidity, gait disturbance, postural instability and bradykinesia. Parkinson's disease is the second most common form of neurodegenerative disease, affecting about 1%- 2% of the population older than 60. As the populatin of the elders is growing, more and more attention is attracted to how to prevent or treat PD.Although the etiopathology of PD remains elusive, mitochondrial dysfunction and oxidative stress may be involved in disease pathogenesis. The deficit of Complex I in the mitochondrial respiratory chain was firstly reported by Schapira and his colleagues, and then the deficit of Complex I in platelets, lymphocytes and muscles was found. Consistent with this, after chronic exposure to rotenone, a specific Complex I inhibitor, rats showed anatomical, neurochemical, behavioral and neuropathological changes similar to human PD. Postmortem researches showed that in the substantia nigra of patients with PD the cellular reactive oxygen species (ROS) level increased and the cellular glutathione (GSH) level decreased, which led to oxidative damage to lipid, protein and mitochondrial and genomic DNA.PD is characterized pathologically by the selective loss of dopaminergic neurons in substantia nigra and the presence of intracytoplasmic protein inclusions called Lewy bodies (LB). Histological research showed thatα- synuclein is one of the main components of LB.α- Synuclein is a presynaptic protein of unknown function. It is reported that it may be involved in regulating cell growth and differentiation, synaptic plasticity, and the release of neurotransmitters and some signal transduction pathway. The point mutations, A53T, A30P, and E46K, in the SNCA gene which encodesα- synuclein cause family PD. And the duplications or triplications of the normal wild-type allele of SNCA lead to autosomal dominant PD, which suggests that the quantity ofα- synuclein expression without point mutations can also be the reason for PD. Furthermore, patients with sporadic forms of the disease present with abnormalα- synuclein accumulation and aggregates in a subset of central and peripheral neurons. Moreover it's reported that increasedα- synuclein levels can be neurotoxic both in vitro and in vivo. The involvement ofα- synuclein in PD points to the possibility that strategies aimed at suppressingα-synuclein may potentially halt or slow down the progression of dopaminergic cell death in PD.RNA interference (RNAi) is one method to suppress gene expression. It refers to the specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). It silences gene on post- transcriptional level. Because of its high efficiency and specificity, it provides a new tool to investigate the gene function and gene therapy. In mammals, there are several strategies to knock down the expression of mRNA. And shRNA expression vector is the most stable and durable method.It's reported that 1- methyl- 4- phenylpyridinium ion (MPP+) could induce mitochondrial dysfunction and oxidative stress in SH-SY5Y cells, while α-synuclein knockdown protected SH- SY5Y cells against MPP+. However, whether the mitochondrial dysfunction and the oxidative stress in MPP+ treatedα- synuclein knockdown cells are attenuated is unknown.In the present study, the shRNA expression plasmid targetingα- synuclein was constructed and transfected to SH- SY5Y cells using gene engineering, RNA interference and cell culture. After that, stable transfected cells were selected by G418. Then the PD in vitro models was made by MPP+ treatment. And then RT-PCR, MTT assay, DCFH- DA assay, flow cytometry and Western blotting were used to explore the effect ofα-synuclein knockdown on mitochondrial function, the Bcl-2/ Bax expression and the oxidative stress. The experiments were divided into 3 parts.PART I THE CONSTRUCTION OF THE RNAi EXPRESSION VECTOR AND ITS SILENCING EFFECTS ONα- SYNUCLEIN EXPRESSION IN SH-SY5Y CELLSObjective: To construct the RNAi expression vector targetingα- synuclein gene (SNCA), and study its silencing effect onα- synuclein expression in SH-SY5Y cells.Methods:1. The construction of RNAi expression vector targeting SNCA: Design and construction of siRNA oligonucleotides according to the pGenesil vector and the siRNA sequence were confirmed to be valid by a previous report. The whole oligonucleotides template chain is as follows: 5'-TTGGACCAGTTGGGCAAGAA TTTCAAGACGATTCTTGCCCAACT GGTCCTTTTTTG-3'. The sequence of the negative control is 5'-GATCCGACTTCATAAGGCGCATGCTTCAAGACGGCAT GCGCCTTATGAAGTCTTTTTTGTCGACA-3', which bears no homology to any sequences in the human genome database. Therefore, the transcript- hairpin siRNA is expected to have no interference on human genes. Then they were annealed and ligated into a linear pGenesil- 2.2 vector. The recombinant plasmid pGenesil-α-syn- shRNA and pGenesil-scrambled shRNA were transformed respectively into E coli. DH5a. After screening kanamycin- resistant (kanr) clones, the plasmids were collected. And then they were identified by PCR and DNA sequenee analysis.2. Investigate the silencing effect onα-synuclein gene: pGenesil-α- syn-shRNA (α- syn- shRNA) and pGenesil-scrambled shRNA (control vector) were transfected into SH- SY5Y cells using LipofectamineTM 2000 according to the manufacturers' instructions. Stably transfected cells were selected by G418 (400μg/ml) 24 h after transfection. The expression level ofα- synuclein was analyzed by Western blotting.Results:1.α- Syn- shRNA and control vector were digested by Sal I enzyme and prepared for agarose gel electrophoresis. A 620bp DNA band was observed under ultraviolet. The DNA sequencing results showed that the inserted sequences were the same with the designed shRNA fragments.2. Stable transfected cells were obtained with G418 resistance. The results obtained from Western blotting showed that compared with control,α- syn- shRNA inhibitedα- synuclein protein expression significantly, while pGenesil- scrambled shRNA had no effect onα- synuclein protein level.Conclusion: The interfering sequence was successfully cloned into the vector.α- syn- shRNA transfection is an effective and long term silencing method of endogenousα-synuclein. PART IIα- SYNUCLEIN KNOCKDOWN SUPPRESSED MPP+- INDUCED MITOCHONDRAL DYSFUNCTION OF SH- SY5Y CELLSObjective:1. To evaluated the effect ofα- synuclein knockdown on cell apoptosis and mitochondrial function in MPP+- induced PD in vitro model.2. To evaluated the effect ofα- synuclein knockdown on Bcl- 2/ Bax expression.Methods:1. After the cells were incubated in MPP+- free medium or medium containing 500μM MPP+, MTT assay were used to evaluate the cell viability.2. After incubating in MPP+- free medium or medium containing 500μM MPP+ for 24 h, cells were washed twice with PBS and incubated with 10μg/ml Hoechst 33258 to show the nuclear morphology.3. The mitochondrial membrane potential was detected by flow cytometry.4. Western blotting was used to detecte the expression of Bcl- 2, Bax and Cytosolic cytochrome c in control orα- syn- shRNA transfected cells.Results:1. After treatment with MPP+ for 24 h, the cell viability of control cells, control vector transfected cells andα- syn- shRNA transfected cells was decreased to 67.7±2.9%, 6.5±3.3% and 89.6±2.7%, respectively. The difference between MPP+-treated control cells andα-synuclein knockdown is significant (p <0.05).2. Very few control cells or cells transfected withα- syn- shRNA showed apoptotic nucleus (0.89±0.4% and 1.03±0.6%, respectively). After 500μM MPP+ treatment for 24 h, 30.2±1.6% of cells exhibited apoptotic nucleus. However the percentage was 14.2±1.3 % in cells transfected withα-syn-shRNA. The difference between them is significant (p<0.05). 3. The results showed that after exposure to 500μM MPP+ for 24 h, about 41.0±1.5% control cells showed low mitochondrial membrane potential. However, the percentage was 13.6±1.2% in MPP+ treatedα- synuclein knockdown cells. The difference is significant (p <0.05).4. MPP+ induced cytochrome c release significantly, which was about 3.1- fold compared with that of control. However, inα- synuclein knockdown cells, the release of cytochrome c was blocked, which was about 1.4- fold compared with that of control. It's significantly lower than the former (p <0.05). The Bcl- 2/ Bax ratio of SH- SY5Y cells reduced to 35.5±3.8% after MPP+ treatment, and this ratio was 85.2±3.0% in MPP+ treatedα- synuclein knockdown cells. It's significantly higher than the former (p <0.05).Conclusion:α-Synuclein knockdown suppressed the MPP - induced apoptosis and protected mitochondrial normal function.α- Synuclein knockdown may afford significant neuroprotection against MPP+- induced injury via up-regulation of Bcl-2/ Bax ratio, attenuating the depression of mitochondrial membrane potential, inhibiting cytochrome c release to cytosole and preventing apoptosis.PART IIIα- SYNUCLEIN KNOCKDOWN ATTENUATED MPP+- INDUCED OXIDATIVE STRESS OF SH- SY5Y CELLSObjective: To study the effect ofα- synuclein knockdown on ROS and GSH level in MPP+- induced PD in vitro model.Methods: DCFH- DA was introduced into cells and intracellular ROS level is measured using multi- detection microreader plate. The intracellular GSH level is tested by GSH assay kit.Results: Compared to the control group, the intracellular ROS level of SH-SY5Y cells increased to 234.7±3.8% after MPP+ treatment. Inα- syn- shRNA transfected cells, the ROS level was 149.2±8.2% after MPP+ treatment, which is significantly lower than that of the MPP+- treated normal cells ( p<0.05). The intracellular GSH level in MPP+- treated normal cells was 56.0±3.5% of the normal control group. Inα- syn- shRNA transfected cells, the percentage is 61.1±3.2%, which is much higher than that of the MPP+- treated normal cells (p<0.05).Conclusion:α- Synuclein knockdown attenuated MPP+- induced elevated ROS level and GSH depletion, which may be one of the reasons whyα- synuclein knockdown suppressed the neurotoxicity of MPP+.Summary:The shRNA expressing plasmid constructed by gene engineering could downregulate theα- synuclein expression and suppress MPP+- induced apoptosis and nuclear morphological changes in SH-SY5Y cells.α- Synuclein knockdown may afford significant neuroprotection against MPP+- induced injury via upregulation of Bcl-2/ Bax ratio, attenuating the depression of mitochondrial membrane potential, inhibiting cytochrome c release to cytosole, preventing cellular ROS elevation and GSH depletion, thus protecting mitochondrial normal function and maintaining normal oxidative stress.
Keywords/Search Tags:Parkinson's disease, α- synuclein, mitochondrial function, RNA interference, oxidative stress
Related items