Study On The Associations Of APOBEC3G Expression Levels, HIV Vif Mutations With Disease Progression In Chinese HIV/AIDS Patients

ObjectiveHuman innate immune system plays important role in HIV infection.APOBEC3G (Apolipoprotein B mRNA-editing Enzyme,Catalytic Polypeptide-like 3G),is a novel cellular factor of innate immunity and is able to inhibit the replication of HIVΔvif(HIV with vif deficiency).Vif is one of the accessory proteins of human immunodeficiency virus type 1(HIV-1).It acts during the stage of assembly,budding,or maturation to augment the infectivity of progeny virions in a producer cell-dependent manner.The studies in vitro have shown that APOBEC3G catalyzes the conversion of cytosine to uracil in negative-stand viral cDNA,resulting in lethal mutations in viral DNA and the inhibition of HIV replication.The Vif protein counteracts the activity of APOBEC3G by inducing its degradation through ubiquitine-proteasome pathway.However,the degradation of APOBEC3G by Vif is in a dose-dependent manner.Higher expression levels of APOBEC3G can overcome the vif-induced degradation.In addition,the degradation of APOBEC3G induced by Vif would be impaired and even disappear if substitutions accur in some important amino acids of Vif.Till now,the expression levels and antiviral abilities of APOBEC3G in HIV-infected individuals,as well as the correlation between APOBEC3G and HIV disease progression are unclear.The association between Vif mutations and APOBEC3G expression in HIV-infected patients has not been reported.The genetic background,immunological features,main HIV-1 subtype and infection pathway of Chinese subjects infected by HIV are different from those of foreigners,and there are no researchs about APOBEC3G and HIV Vif on Chinese HIV/AIDS patients.So,in this study,we focus on the HIV/AIDS patients in China who are at different disease progression stage.We studied the APOBEC3G levels in PBMC,the gene sequences of HIV-1 Vif so that we could investigate the association of APOBEC3G levels,Vif mutations with HIV disease progression,and the influence of Vif mutations on APOBEC3G expression for the first time.In addition,the regulation of IFN-αon the expression of APOBEC3G were also investigated in vitro.The study aims at screening cellular factor of innate immunity delaying HIV disease progression,and providing valuable information for the design of vaccine and treatment of AIDS.Material and Methods1.Study subjectsHIV/AIDS patients were from Henan province of China.Every subject was confirmed to be HIV-1 antibody positive by confirmatory western blot test and was antiretroviral therapy na(i|¨)ve before blood sample collection.Informed consents were signed by all subjects before being investigated and providing blood samples.Subjects were classified into three groups:slow progressor(SP),chronical HIV-infected subjects (HIV) and AIDS,depending on their course of infection and CD4⁺ T cell counts.The individuals who have been infected with HIV-1 for more than ten years with persistent CD4⁺ T cells＞500/μl and shown no HIV symptoms were classified as SP group.The individuals who have been infected with HIV-1 for more than 5 years with CD4⁺ T cells between 200/μl to 500/μl and without defined symptoms were classified as HIV group.Those with CD4⁺ T cell counts＜200/μl were classified as AIDS group.Healthy controls were from the same region of Henan province and were negative both in HIV antibody and other diseases.HIV-1 B' subtype was determined and confirmed by phylogenetic analysis based on part of env,pol and gag gene regions.2.CD4⁺T cell countsCD4⁺T cell counts were measured using TriTEST CD4FITC/CD8PE/CD3PerCP reagent with 20μl anticoagulated whole blood.After incubation for 15 minutes in the dark at room temperature,FACS lying solution was added and then incubated.CD4+ T cell counts and corresponding ratios were obtained by flow cytometer analysis with FACS MMLTISET software.3.Viral load assayPlasma HIV RNA was quantified with Amplicor HIV-1 Monitor test,version 1.5 (Roche Diagnostics,Rotkreuz Switzerland) by an ultra-sensitive modification.4.Construction of the standard plasmidsPBMCs were extracted from EDTA anticoagulated blood of healthy individuals. Cellular total RNA was extracted with RNeasy mini kit(Qiagen).The RNA was reverse transcribed according to the ImProm-â…¡^TM Reverse Transcription System(Qiagen).The open reading frames of APOBEC3G and GAPDH were amplified by PCR.The PCR products were purified and coloned into pGEM-T vectors(Promega),and cloning sequences of the plasmids were confirmed by DNA sequencing.The copies of every plasmid was quantitated using ultraviolet spectrophotometer.Each standard preparation was prepared by serial dilutions of plasmid.5.Quantification of APOBEC3G mRNA levels by Real-time PCRPBMCs were extracted from EDTA anticoagulated blood of healthy controls and HIV-infected patients.Cellular total RNA was extracted with RNeasy mini kit(Qiagen). The RNAs were reverse transcribed according to the ImProm-â…¡^TM Reverse Transcription System(Qiagen).The sequence of Taqman probes for APOBEC3G was FAM-GCAACCAGGCTCCACATAAACACGG-NFQ and GAPDH was FAM-GGAC TCATGACCACAGTCCATGCCA-NFQ,respectively.First-strand cDNA products were diluted and used in a 25μl reaction mixture contained 2×TaqMan^? Universal PCR Master Mix 12.5μl,20×TaqMan Gene Expression Assay 1.25μl,and RNase/ DNase-free water.All reactions were run in an ABI 7500,with 1 cycle at 50℃(2 min) followed by 95℃(10 min) and 40 cycles of 95℃(15 s) followed by 60℃(1 min). Data were collected and analyzed using Sequence Detection software(ABI).Absolute mRNA copy numbers were calculated by generating standard curves using serial dilutions of plasmids containing the desired gene.Each sample was run in duplicate.6.Detection of the expression of APOBEC3G by Western blotAPOBEC3G protein was quantified by Lowry method.50μg protein was used in SDS-PAGE electrophoresis and analyzed.7.Nest-PCR and sequencing of VifHIV-1 DNA from peripheral blood was extracted with QIAamp Viral DNA Mini Kit(Qiagen,German) according to the manufacture's recommendations.5μlDNA was used to Nest-PCR.The outer primer sequences were Po15:GAAGCCATGCATGGACA GGT,Vif2:AGGCTGACTTCCTGGATG.The inner primer sequences were Vif3:CAT AAAAGTAGTGCCAAGAAGAAAAG,Vif4:TCTTAAGCTCCTCTAAAAGCTC. PCR products were purified with QIAquik Gel Extraction Kit and sequencied with BigDye Terminator Sequencing kit in ABI 377 sequence analyzer.HIV Vif sequences of main subtypes in the world were download from HIV database(http://www.hiv.lanl.gov).Sequences were edited and aligned by BIOEDIT software.Phylogenetic analysis was conducted by MEGA3.1 software.Amino acid sequences of Vif gene were obtained from the translation of nucleotide acid sequences and compared with the reference sequences.8.IFN-αstimulation testPBMCs extracted with Ficoll from healthy controls and HIV-infected patients were cultured in RPMI1640(10%FBS,37℃,5%CO₂).The PBMCs were infected with 500TCID₅₀ of SF33 and/or cocultured with final concentration of IFN-αof 100U/ml,400U/ml,800U/ml. Culture supernatants of designate time were collected and frozed in -20℃in order to detect p24.Meanwhile,PBMCs of the same wells were collected and washed with PBS for total RNA and protein extraction,and then were used for determination of APOBEC3G mRNA and protein.9.Quantitation of p24 in culture supernatantp24 antigen was detected by Biomerieux ELISA kit according to instruction.10.Statistical AnalysesStatistical analyses were performed using SPSS 13.0.The means and SD were used for data analysis in comparison.Differences between the groups were assessed using two-sample t test for two groups or one-way ANOVA for more than two groups and subsequent Student-Newman-Keuls test.The viral loads were log₁₀ transformed before analysis,and the mRNA copies of APOBEC3G were calculated as copies per 100,000 copies of GAPDH mRNA and then log transformed(base e) for statistical analysis.Correlation between two quantitative variance was tested by Pearson correlation coefficient.Comparisons and analysis between DNA sequences were completed by 2-tailed Fisher's exact test.The results were obtained comparably by x² test. Results1.Comparision of APOBEC3G levels among HIV/AIDS patientsThe mRNA levels of HIV/AIDS patients were lower than that of healthy controls, and SP were higher than that of HIV and AIDS(P＜0.05).The protein levels of healthy controls and SP were higher than that of HIV and AIDS(P＜0.05).2.The correlation between APOBEC3G mRNA and protein levels in PBMCs of HIV/AIDS patientsThe mRNA and protein levels of APOBEC3G were correlated positively with each other in PBMC of HIV/AIDS patients(r=0.801,P＜0.001).3.Correlations of APOBEC3G mRNA expression levels with CD4⁺ cell counts and viral loadsThe mRNA expression levels of APOBEC3G were positively correlated with CD4⁺ T cell counts(r=0.436,P=0.002) and negatively with viral loads(r=-0.306, P=0.038) in HIV/AIDS patients.4.Analysis of amino acids in Vif which are important of interacting with APOBEC3GThe amino acids of important function domains in Vif were fairly conservative except for very few substitutions in E88WRKKR93 motif.Amino acid 92 was polymorphism.But this substitution didn't change APOBEC3G levels.5.Analysis of other amino acid signatures in VifThe substitution of V7A was associated with lower viral loads and higher CD4⁺T cell counts.While F39V substitution was associated with higher viral loads and lower CD4⁺ T cell counts.Both substitutions didn't change APOBEC3G levels.6.The induction of IFN-αon APOBEC3G levels in vitroIFN-αcan induce the expression of APOBEC3G at both mRNA and protein levels in PBMCs of both healthy controls and HIV-1-infected individuals.The influence of IFN-αon APOBEC3G expression is in a dose-dependent manner. Conclusions1.The levels of APOBEC3G in PBMCs of Chinese HIV/AIDS patients were associated with HIV disease progression.Higher expression levels of APOBEC3G may be related to the slow progression of SPs.2.The important motifs and amino acids of Vif sequences,which interact with APOBEC3G,were relatively conservative in HIV-1 B' subtype of China.The substitution of V7A was associated with lower viral loads and higher CD4⁺T cell counts.While F39V substitution was associated with higher viral loads and lower CD4 ⁺ T cell counts.Both substitutions didn't change APOBEC3G levels.V7A and F39V substitutions may be viral factors that influent diseae progression independent of APOBEC3G levels.3.IFN-αcan induce the expression of APOBEC3G at both mRNA and proteins levels in PBMC of HIV-1-infected individuals,which is associated with the inhibition of HIV-1 replication.