Font Size: a A A

Screening And Identification Of Lipopolysaccharide Binding Peptides From Phage Random 7-mer,12-mer Peptide Library

Posted on:2008-04-08Degree:DoctorType:Dissertation
Country:ChinaCandidate:H J YangFull Text:PDF
GTID:1114360278976770Subject:Pathology and pathophysiology
Abstract/Summary:
Background and objective:Sepsis and the multiorgan failure that frequently accompanies severe infection remains a leading cause of mortality in the intensive care unit .It is estimated that about 650–750,000 patients develop sepsis annually in the United States, with similar incidences in Europe and around the world . Nearly half of septic patients develop severe sepsis and septic shock. The mortality for septic shock remains approximately 30–45%, despite aggressive supportive care numerous attempts to improve the treatment options and outcome.The basic of septic shock is that microbial antigens such as Gram-negative bacterial Lipopolysaccharide (LPS), or endotoxin, initiate an uncontrolled network of host-derived inflammatory mediators. If systemic levels of inflammatory cytokines remain elevated for long enough, the patient may experience"endotoxic shock"or"sepsis", which are characterized by hypotension, coagulation abnormalities, and multiple organ failure.LPS is a potent activator of cells of the immune and inflammatory systems and contributes to the systemic changes seen in septic shock. LPS directly or indirectly evokes numerous tissue and cell inflammatory responses. Therapeutic strategies in cases of sepsis include neutralization of endotoxin by peptides or anti-LPS antibodies, use of its non-toxic analogs that prevent its binding to the susceptible cells or the molecules that compromise the cascade of events that cause the production of inflammatory cytokines such as tumor necrosis factorα(TNF), interleukin-1, interleukin-6, etc.. Of these interventional modalities, neutralization of LPS by peptides or proteins is quite an attractive one.Phage display is a simple functional genomic methodology for screening and identifying protein–ligand interactions and is widely used in epitope mapping, antibody engineering and screening for receptor agonists or antagonists. Phage display is also used widely in various forms, including the use of fragment libraries of whole microbial genomes, to identify peptide–ligand and protein–ligand interactions that are of importance in infection. It's also an important method in DNA shuffling and direct molecular evolution. In our study, we use this technique to identify LPS-binding peptides to provide new ideas of direct-evolution for understanding LPS- induced SIRS and may find new treatment for endotoxemia.Methods:Rabbit anti-LPS polyclonal antibody were prepared for post research. Phage display technique was employed in our study. After 4 rounds Of biopanning to phage random7-mer and 12-mer peptide library, phage clones binding to LPS were identified. They were selected and amplified .The binding activity measureed by ELISA and Plaque reduction test of these phage clones were performed. The DNA of these phage clones were extracted for sequencing as described in manual. The peptide sequences were deduced from DNA sequences. Those peptides were analysed by bioinformatics.Through Blast, the peptide sequences were compared for homology analysis. The peptide was synthesized by the solid-phage method, and biologic activity of the peptide was texted by using ELISA,FACS,RT-PCR and so on.Results:1. Rabbit anti-LPS polyclonal antibody were prepared ,It can be used for post research.2. Using LPS as target, 4 rounds of biopanning were performed as described in methods. The bound phages were eluted by the glycine solution. The phage clones that display LPS binding peptide were concentrated from the NEB Ph.D.-7TM and NEB Ph.D.-12TM phage-displayed peptide library.3. After four rounds of biopanning, the eluted phage were characterized by phagemid ELISA and Plaque reduction test and DNA sequencing.160 eluted clones were examined and most of them could bind LPS specifically, and amino acid sequence of random peptide of 19 positive clones were identified. those peptides were analysed by bioinformatics.The core DNA sequence of 12-mer peptide library is CGGAGGCGGACTCTTATGAA TCCACT,The core DNA sequence of 7-mer peptide library is CGGAGGCGGATTCTC ATGAAA, The peptide sequences were deduced from DNA sequences from these phage clones, we found the core peptide sequence of 19 phage clones was HWQWPHWSPPP, we named it P11 peptide. P11 was retrieved from patent database, found no patend was claired. Through Blast, the peptide sequences were compared with many protein for homology analysis. We found 908 protein matching the peptide. These protein include a group related to proinflammatory events, a group of related to prothrombotic function, a group of related to cellular apoptosis, a group related to cytoskeietal rearrangment, a group related to energy metabolism, a group related to signal transduction and a group of unknown function proteins(about 207). Some of the retrievaled gene were corresponding to known LPS responsive genes such as E-selectin, Human Interleukin-6 Receptor,Interleukin-4 Receptor alpha chain complex,Solution Structure Of The Primary Host Recognition Region Of Complement Factor H,Cytokine Receptor Complex,C-type lectin, superfamily member 6 isoform 2,zinc finger protein 645 and so on. We also found many genes previously not known to be responsive to LPS such as laminin receptor,phospholipase A2 receptor 1 isoform 2 precursor,transmembrane 9 superfamily member 2 and so on.4. P11 was synthesized by the solid-phage method, NH2 was added at the C-end of HWQWPHWSPPP. The synthesized peptide purity exceed 99%,MWt assayed by mass-spectrum is 1453.8, the theory MWt is 1453.6,the structure and purity of the pepide is correct,The peptide can be used for biologic activity test.5. LPS could bind with P11. The relative binding activity to LPS of P11 was lower than that of PMB(B (polymyxin B) in the same mass concentration.6. P11 was analysed by growth curve test and FlowCytomix test, found no significant compaired with the negative control.7. High dose of The synthetic peptide(10μg/ml) could inhibit the TNFαsecretion significantly in LPS- induced U937 cell.Conclusions:The selected peptides that bind to LPS from NEB Ph.D.-7TM and NEB Ph.D.-12TM phage-displayed peptide library were screened by using LPS as a ligand . After four rounds of biopanning, the core amino acid sequence of random peptide was HWQWPHWSPPP. Through Blast, the peptide sequences were compared with many protein for homology analysis. We found 908 protein matching the peptide. the synthetic peptide have no significant effect on growth of U937 cell. High dose of the synthetic peptide HWQWPHWSPPP -NH2 (10μg/ml) could inhibit the TNFαsecretion significantly in LPS- induced U937 cell.The results show that peptides binding LPS could be selected from phage-displayed peptide library. It provide new ideas of direct-evolution for understanding LPS- induced SIRS and may find new treatment for endotoxemia.
Keywords/Search Tags:lipopolysaccharide, direct-evolution, phage random peptide library, peptide, tumor necrosis factor alpha
Related items