| Oxytocin is traditionally regarded as a hormone which was involved in the parturition and milk ejection. In recent years, more evidence indicated that OT may play a role in regulation of the gastrointestinal functions, such as motility, sensation and immune response to inflammation. Exogenous oxytocin influences the GI motility, although the results are diverse because of the difference of species, methods and area of the gut. It has been well established that mRNA for oxytocin and its receptor can be found throughout the human GI tract, but the cell types that express OT receptor (OTR) was undetectable in human gut by indirect immunofluorescence.In women, colonic dysmotility is very common and bowel function changes during the reproductive cycle. Although the fluctuation of steroid hormones, especially estradiol and progesterone, were believed to be the major reason, the mechanism has not been clearly illustrated. As far as we know, there is no report about the effect of estrogen on the protein expression of OTR in rat colon. We hypothesized that cyclic change of estrogen in plasma during estrous cycle might influence the expression of OTR in colon. In order to test this hypothesis, we monitored the colon motility in female rats at different phases of the estrous cycle, or in ovariectomized rats treated with different dose of E2 or vehicle. The level of OTR and OTR mRNA expressed in colon were compared between OVX rats treated with E2 and vehicle. OTR in OVX rats in colon was located by Experimental animalsFemale Wistar rats, weighing 200-220 g, were employed in these experiments. Ovariectomy was performed under light ether anesthesia. The ovaries were picked out by a forceps through a 1-cm incision made over both flanks of the rat. A ligature was placed below the ovary and the ovary was removed, then the incision of the muscle and fur were sewed up by aseptic suture line, and finally the wounds were disinfected by Iodophors. Two weeks after bilateral ovariectomy, 32 female rats were randomly divided into four groups. The rats of the three experimental groups were treated with E2 (4, 25, 100μg kg-1, s.c.) once daily for 6 days; the rats of the control group were treated with sesame oil (1 ml kg-1, s.c). Twenty hours after the last injection, rats were employed for both experiments.Female rats at different stages in the estrous cycle were employed and the stage of each rat was verified by vaginal smears.Measurement of uterine weight and E2 concentrationAfter decapitation, uteri were removed and weighed. Blood was collected from rats and centrifuged at 3000 rpm for 30 min. Serum was kept at 4℃, then the E2 concentration were measured with an assay under Automated Chemiluminescence System (Roche E170, Roche company, Swiss) .Preparation of muscle strips and recording of the tension of colon in vitro Rats were fasted over-night but allowed to drink water before the experiment. Immediately after rat decapitation, a segment of distal colon (5 cm from anus) was removed. The segment was opened along the mesenteric border and the resulting rectangular sheet was pinned flat in a Petri dish filled with oxygenated Krebs solution. Muscle strips (8×3 mm) were cut parallel to the longitudinal fibers, and they were designated as longitudinal muscle. The prepared muscle strips were suspended in tissue chamber containing 5 ml Krebs solution (37℃) which bubbled continuously with 95% O2 and 5% CO2. One of the narrow ends of the strip was tied to a hook at the bottom of the chamber. The opposing end was connected to an external isometric force transducer. The temperature of the chamber was kept at 37±0.5℃. Tension of colonic strips (under an initial tension of 1 g) in the tissuechambers was recorded using a polygraph system. To stabilize background contractions after excision, the muscle strips were initially equilibrated in the tissue chamber for at least 90 min. During this period the bath medium (37℃) was replaced every 15 min. OT was administered to the chambers after the spontaneous contraction of colonic strips had become stable. Each muscle strip was exposed to OT only once and tension was recorded continuously for 40 min after OT administration. Isometric contraction of rat longitudinal smooth muscle was monitored.Recording of the colon motility in vivoAfter being anesthetized with amobarbital sodium, the rats were fixed on the homeothermal operation table (37℃) .The rat trachea was cannulated to facilitate the ventilation and the right femoral artery was cannulated to monitor the blood pressure. In order to monitor the colonic pressure, a plastic ballonet made of the condomwas inserted into the colon. Another end of the catheter was connected with a pressure transducer through the catheter. The signals from the two transducers were amplified by biological amplifier and recorded by polygraph. Normal saline (0.7 ml) was infused into the ballonet to maintain the pressure in the ballonet at about 10mmHg.Western blotMuscle strips of the colon prepared as above were homogenized for protein analysis. After separation by SDS-PAGE, proteins were transferred to nitrocellulose membranes. Then the membranes were blocked, incubated anti rat OTR IgG (1:400, sc 8102; Santa Cruz Biotechnology). Finally, immunoreactive bands were quantified after autoradiography.RT-PCRMuscle strips of the colon prepared as above was homogenized in trizol for total RNA extraction. RNA reverse transcription was completed using High-Capacity cDNA Reverse Transcription Kit (4368814, ABI). The primer pair of OTR (F: 5'-TGTTCGCCTCCACCTACC -3'R: 3'-TTCACCGCCTGCCTCAGA-5')andβ-actin (F:5'- TCTACAATGAGCTGCGTGTGG -3'R: 5'- GGAGTCCATCACAATGCCAGT - 3') were used to amplify their homologus gene from the extracted genomic DNA (Invitrogen, Shanghai, China).ImmunohistochemistryRats were fasted over-night but allowed to drink water before the experiment. Immediately after rat decapitation, a segment of distal colon was removed and experienced a series of soaking in paraformaldehyde, dehydrating, clearing and immersing in wax. Then the tissue can be sectioned with 4 urn thickness. The sections were incubated with primary goat anti-oxytocin receptor antibody (Santa Cruz, diluted 1:100 in PBS), positive cells were stained by DAB.Statistical analysisThe data was presented as mean±SEM, with n indicating the number of rats. One-way ANOVA analysis followed by Dunnett's test was used to analyze the difference between groups. P < 0.05 was considered as significant difference.RESULTS(1) In OVX rats, E2 replacement dose dependently increased the E2 concentration in plasma and uterine weight. OT significantly increased the colon motility in OVX rats treated with E2 (4, 25, 100μg/kg-1 day-1, 6 days) compared with OVX rats treated with sesame oil.(2) The concentration of E2 is highest in rats at proestrus and lowest in diestrus stage. Systemic administration of OT (1.5μgkg-1) significantly increased the colon motility in rats at proestrus and estrus, but did not affect colon motility at diestrus stage.(3) Pretreatment of atosiban (3.75μg kg-1, i.v.) completely abolished the excitatory effect of OT (1.5μgkg-1, i.v.) on the motility of colon in OVX rats with E2 replacement.(4) In order to exclude the possibility that OT influenced colonic motility through vasopressin receptors, we investigated the effect of vasopressin on colon pressure in OVX rats with E2 replacement (25μg kg-1 day-1, 6 days). Systemic administration of vasopressin (0.03 - 3μg kg-1) dose dependently decreased blood pressure but increased colonic pressure.(5) OT (10-7 M) excited the motility of longitudinal muscle strips of distal colon of OVX rats treated with middle and high doses of E2 (25, 100μg kg-1), but did not influence the contraction of muscle strip of colon in OVX rats treated with oil (vehicle control) and low dose of E2 .(6) E2 replacement significantly up-regulated OTR expressed in colon of OVX rats. Treatment with middle dose of E2 increased the relative amount of OTR in colon and high doses exerted a similar effect. (P < 0.05, n = 6).(7) E2 replacement significantly up-regulated the expression of OTR mRNA in colon of OVX rats treated with middle dose of E2 (P < 0.05, n = 6).(8) The cells with OTR immunoreactivity were located in myenteric plexus of colon and smooth muscle of uterine smooth muscle. E2 replacement (25μgkg-1 and 100μg kg-1, 6 days) increased the number of OTR immunoreactive cells and the intensity of the immunoreactivity of the lablled cells.(9) Pretreatment of TTX (10-5 M) completely blocked the excitatory effect of OT on the contraction of longitudinal muscle strips of proximal colon from OVX rats with E2 replacement ((25μg kg-1 day-1,6 days).CONCLUSIONIn conclusion, we found that E2 upregulated the OTR in rat colon, and then increased the colon sensitivity to the excitatory effect of OT on colon motility. OTR was expressed in enteric plexus in rat colon.
|
PDF Full Text Request