An Essential Role For STIM1/SOC In Vascular Smooth Muscle Cells Proliferation

BACKGROUNDAtherosclerosis is a common medical problem and has major impact on survival, quality of life, and health services. The atherosclerotic process is characterized by the recruitment of monocytes and lymphocytes to the arterial intima. The subsequent accumulation and proliferation of vascular smooth muscle cells (VSMCs), which immigrate from the medial layer, lead to lesion progression and encroachment on the coronary vascular lumen. Despite the fact that the use of percutaneous coronary intervention (PCI) has improved the results of atherosclerosis significantly, understanding restenosis after PCI remains a challenge. Restenosis refers to the re-occurrence of stenosis on the basis of intimal lesion, and the major contribution to this process is the proliferation and migration of medial VSMCs. Therefore, proliferation of VSMCs is a key event in atherosclerosis and restenosis after vascular injury; however, the underlying mechanism of VSMCs proliferation is unclear.Ca2+ channels are of particular interest in cell proliferation because of the profound anti-proliferative effect of removing extracellular Ca2+, and evidence from studies of many cell types that Ca2+ entry mechanisms have an essential role. Elevation of Ca2+ levels in VSMCs can result from entry of extracellular Ca2+ as well as release of Ca2+ sequestered within organelles such as the sarcoplasmic reticulum (SR). Ca2+ influx across the plasma membrane (PM) is mediated by voltage-dependent Ca2+ channels, and voltage-independent cation channels, including store-operated Ca2+ channels(SOC). It has been recognized that phenotypic modulation of VSMCs is associated with downregulation of voltage-dependent Ca2+ channels, which provide Ca2+ entry for contraction when the cells are in the contractile phenotype of the physiological blood vessel, and are the target of antihypertensive calcium antagonist drugs. What are the Ca2+ channels of the proliferating VSMC? Store-operated Ca2+ entry (SOCE), also known as capacitative Ca2+ entry, is thought to have an essential role in the regulation of contraction, cell proliferation, and apoptosis. Meanwhile, it has been reported that SOCE has been detected in VSMCs.The activation of SOCE is triggered by a reduction in the concentration of SR Ca2+. Transient discharge of SR Ca2+ occurs during the course of signaling events that activate inositol 1,4,5-trisphosphate receptors (IP3R) or ryanodine receptors in the SR membrane. SR Ca2+ stores can be depleted by inhibiting sarcoendoplasmic reticulum Ca2+ ATPases (SERCA) with thapsigargin. Although several biophysically distinct SOCE have been reported, the best characterized are the Ca2+ release-activated Ca2+ (CRAC) channels. Over the years, many genes have been claimed to code for the CRAC channel. Recently, an RNAi-based screening approach revealed a novel membrane-spanning protein named stromal interaction molecule 1 (STIM1) to be required for activation of SOCE. STIM1 is dispersed on the endoplasmic reticulum (ER) membrane under quiescence. Ca2+ store depletion stimulates redistribution of STIM1 to the PM. The redistribution is thought to transmit a store depletion signal to the CRAC channels in the PM. Evidence indicates that STIM1 may function as a Ca2+ sensor in the ER, leading to transduction of this signal to the PM, and opening of store-operated Ca2+ channels located in the PM. Nevertheless, there has been relatively little association of STIM1 with human disease, little direct evidence that STIM1 knockdown could be an effective therapeutic strategy, and no link between STIM1 and organ function. We have focused on the suggestion that STIM1 might have a role in vascular disease. Here, we present evidence from in vivo and in vitro studies that STIM1 does have an essential role in the proliferation of VSMCs, and we consider the relevance to the adaptive injury response of blood vessels.METHODS1. Construction of adenoviral vectors: A mixture of two siRNA duplex sequences exclusively targeting rat STIM1, but not human STIM1 were used. (i) Start nucleotide 935, GCAUGGAAGGCAUCAGAAGUGUAUA; and (ii) start nucleotide 970, GGAUGAGGUGAUACAGUGGCUGAUU. Target sequences for rSTIM1 were chemically synthesized as complementary oligonucleotides. Annealed oligonucleotides encoding sense and antisense strands linked by the loop sequence were subcloned into pGS-1. Recombinant viral genomes were transfected into 293 cells in a 6-well plate. Eight days after transfection, the recombinant virus was collected and subjected to one round of amplification in a T-75 flask with 1.5×106 293 cells, resulting in 2 ml of viral stock. The Ad-si/rSTIM1 and Ad-hSTIM1 viruses were titrated using the standard plaque assay. The titer for Ad-si/STIM1 was 3×109 pfu/ml. All adenoviruses expressed GFP under a separate promoter, allowing verification of infection. A nonsilencing control (NSC) sequence was generated in the same manner. Ad-hSTIM1 was gifted from department of biochemistry and molecular biology, university of Auckland.2. The section of animal experiments in vivo: Angioplasty of the rat left carotid artery was performed by using a balloon embolectomy catheter. Some animals were subjected to anesthesia and surgical procedure without balloon injury (sham-operated rats). After balloon injury, solutions of (20μL) Ad-si/rSTIM1, Ad-hSTIM1 or NSC were infused into the ligated segment of the common carotid artery for 20 minutes. At 7 days and 14 days after angioplasty, the carotid arteries were removed, and 6 cross-sections were cut from the approximate middle of the artery. The lumen loss of each group was measured by staining with hematoxylin and eosin. The expression of STIM1 in vessel wall was assessed using quantity RT-PCR, western blot and double-immunofluorescence staining. The proliferation of VSMCs was evaluated by measuring the PCNA expression in vessev wall.3. The section of in vitro experiments: Rat aortic VSMCs were isolated and subcultured, and VSMCs between 3 and 7 passages were used for the in vitro experiments. VSMCs were transduced with Ad-si/rSTIM1, Ad-hSTIM1, or NSC, and STIM1 protein levels were evaluated by western blot. The proliferation of VSMCs was measured by [3H] thymidine incorporation and cell counting. Changes in [Ca2+]i in individual cells were measured using an Aquacosmos system. Cell-cycle distribution was analyzed using flow cytometry. The expression of p21 and pRb were assessed using western blot. Cell migration was analyzed using transwell migration assay.4. Statistical analysis: Results are expressed as mean±SEM of n rats for in vivo experiments and mean±SEM of multiple experiments for molecular biology. SPSS13.0 software was used for statistical analysis. Student t tests were used to compare 2 groups, or ANOVA was used with the Tukey's multiple comparison tests for multiple groups. Values of P <0.05 were regarded as statistically significant.RESULTS1. Successful transduction of Ad-GFP in balloon injured rat carotid artery was documented by Western blot analysis at 3, 7, and 14 days after injury. The level of GFP expression reached a maximum at day 3, and remained high until days 7 and 14 after adenoviral infection. These results suggest that the adenovirus-mediated delivery system was effective in rat carotid artery. The efficiency of adenovirus transfection in VSMCs was examined. Cell numbers were obtained by counting nuclei stained with 4'-6'-diamidino-2-phenylindole (DAPI). The transfection efficiency of adenovirus GFP expression in cultured VSMCs was 92.4±7.6%,2. The section of animal experiments in vivo: STIM1 mRNA and protein were detected in carotid arteries subjected to vascular injury, whereas their expression was low in uninjured right carotid arteries at 7 days and 14 days after balloon angioplasty. Meanwhile, when compared to the sham groups, STIM1 mRNA and protein in the left injured carotid had increased significantly at 7 days after balloon angioplasty, and further increased at 14 days after balloon angioplasty. In addition, immunoreactivity for STIM1 and SMαA was observed mostly in neointima at days 7 and 14. These results suggest that STIM1 is expressed in proliferating SMCs, contributing greatly to neointimal formation.We delivered adenovirus constructs expressing nonsilencing control (NSC), Ad-hSTIM1, and Ad-si/rSTIM1 to rat carotid arteries. Expression of STIM1 protein was confirmed by Western blotting. Compared with the NSC group, incubation with Ad-si/rSTIM1 attenuated injury-induced STIM1 upregulation significantly. Cotransfection with Ad-hSTIM1 reversed the downregulation of STIM1 by RNAi. Interestingly, the neointimal formation area and lumen loss ratio at day 14 were reduced significantly by transfection with Ad-si/rSTIM1 compared with transfection with NSC. When Ad-hSTIM1 was transfected with Ad-si/rSTIM1, the neointimal formation area and lumen loss ratio were restored to near the control level. Concomitantly, the expression of PCNA in rat carotid arteries at 14 days after injury was much lower in the Ad-si/rSTIM1-treated group than in the NSC group. The transfection of Ad-hSTIM1 with Ad-si/rSTIM1 restored the expression of PCNA in rat carotid arteries to near the level of that in the NSC group. In addition, STIM1 knockdown caused an increase in expression of p21, and a significant reduction in phosphorylation of Rb (pRb) in vivo at 14 days after injury. No significantly differences were found between sham group and Ad-si/rSTIM1-treated group on the expression of PCNA, p21 and pRb. 3. The section of in vitro experiments: Transduction of VSMCs with Ad-si/rSTIM1(MOI 15 and 30 pfu/cell) effectively decreased STIM1 protein expression at 48 hours post transduction. The cotransfection of Ad-hSTIM1 (MOI 15 pfu/cell) with Ad-si/rSTIM1 (MOI 15 pfu/cell) restored the expression of STIM1 protein. Interestingly, transfection of VSMCs with Ad-si/rSTIM1 decreased the uptake of [3H]thymidine by VSMCs significantly at 48 hours after infection. The cotransfection of Ad-hSTIM1 reversed the effect of STIM1 knockdown on [3H]thymidine uptake. Concomitantly, transfection of VSMCs with Ad-si/rSTIM1 suppressed proliferation of VSMCs significantly (MOI 15 pfu/cell), and hSTIM1 re-expression reversed the effect of STIM1 knockdown on VSMC proliferation. In addition, transfection of VSMCs with Ad-si/rSTIM1 decreased the number of migrating cells significantly at 48 h after infection. In this rSTIM1 knockdown background, hSTIM1 re-expression reversed the effect of STIM1 knockdown on the number of migrating cells.Cultured VSMCs were first synchronized and stimulated with serum to initiate cell-cycle progression, then infected with NSC, Ad-hSTIM1, and Ad-si/rSTIM1 for 48 hours. Fluorescence-activated cell sorting (FACS) was used to examine cell-cycle distribution. Approximately 13% of VSMCs infected by NSC (MOI 30 pfu/cell) or 16% of uninfected VMSCs progressed into S phase. VSMCs infected by Ad-si/rSTIM1 (MOI 30 pfu/cell) were distributed mainly in the G0/G1 phase, and only 1.6% of cells progressed into S phase. After VSMCs were transfected with Ad-hSTIM1 (MOI 15 pfu/cell), approximately 16% of cells progressed into S phase (Figure 5B). The effect of STIM1 knockdown on cell-cycle arrest was also manifest by alterations in key components of the cell-cycle regulatory machinery. STIM1 knockdown caused an increase in expression of the CDK inhibitor p21, and a significant reduction in pRb, thus permitting accumulation of the hypo-phosphorylated, growth-suppressive form of Rb.We evaluated the effect of small interfering RNA (siRNA) targeted against rSTIM1 on SOCE, which was activated by the depletion of intracellular Ca2+ stores using 1μM TG in the absence of extracellular Ca2+, followed by the addition of extracellular Ca2+ to 2 mM. The TG-mediated SOCE may be attributed to the release of Ca2+ from the SR. The infection of Ad-si/rSTIM1 (MOI 15 pfu/cell at 48 hours after infection) resulted in a marked decrease in SOCE. However, the cotransfection of cells with Ad-hSTIM1 (MOI 15 pfu/cell) reversed the effect of STIM1 knockdown on intracellular Ca2+ of VSMCs.CONCLUSIONSThe present results identify a critical role for STIM1 in neointimal formation in a rat model of vascular injury, and suggest a potential role for STIM1 knockdown in the reduction of neointimal development. Meanwhile, we have demonstrated that STIM1 is a powerful regulator of cell proliferation both in vivo and in vitro. This conclusion is based on several independent lines of evidence.First, an overt upregulation of STIM1 expression in vivo was associated with balloon injury-induced VSMC hyper-proliferation in rat carotid arteries. Second, knockdown of endogenous STIM1 by adenoviral delivery of siRNA significantly suppressed neointimal hyperplasia in vivo, which was reversed by STIM1 replenishment. Third, STIM1 knockdown inhibited SOCE in cultured VSMCs, and blocked serum-induced VSMCs proliferation in vitro, which was also reversed by STIM1 replenishment. In addition, suppression of STIM1 also inhibits VSMCs migration in Vitro.In summary, we show that STIM1 is a critical regulator of VSMC proliferation and neointimal hyperplasia. STIM1 may represent a novel therapeutic target in the prevention of restenosis after vascular intervention.