Font Size: a A A

Mechanism Of MT1-MMP Expression Induced By Low Shear Stress And Inhibited By Simvastatin

Posted on:2010-12-02Degree:DoctorType:Dissertation
Country:ChinaCandidate:L ChenFull Text:PDF
GTID:1114360278474306Subject:Internal Medicine
Abstract/Summary:
Abstract ITHE RELATIONSHIP BETWEEN MT1-MMP AND LOW SHEARSTRESSBackgroundPober and Cotran have raised shear stress hypothesis about atherogenesis aftersummarizing numerous studies related to the relationship between fluid shear stress and atherosclerosis (AS). The hypothesis thinks that abnormal flow shear stress is a critical factor resulting in AS lesion formation.Vascular endothelial cells (VEC) line inner vessel wall experiencing shear stress resulting from blood flow. Abnormal hemodynamic factors induce unsteady laminar shear stress and decrease of atheroprotective molecular secreted by VEC. Therefore, some risk factors persistenting, such as hypercholesteremia and high cysteine, promoted AS. These sites are the most impaired region. Obviously, the characterization of atherosclerotic local distribution mainly is related to the shear stress, unrelated to other related factors.Membrane type-1 matrix metalloproteinase (MT1-MMP, MMP-14) is a protease and a major mediator of the proteolysis of pericellular and membrane-associated substrates, including collagens. MT1-MMP is highly expressed in atherosclerotic plaques. It is involved in monocyte transmigration as well, an important mechanism of early atherosclerotic plaque formation. Recent works provides evidence that MT1-MMP could affect atherosclerosis development and plaque stability. However, the role of MT1-MMP induced by shear stress is unclear.Objectives1. To establish an animal model of low shear stress in high-fat diet ApoE knockout mice2. To elucidate the pathophysiological and mechanisms of low shear stress and MT1-MMPMethods1. Animal protocolMale ApoE-/- mice (n=20) were 10 to 12 weeks of age. Carotid atheroscleroticlesions were induced by perivascular constrictive collars placement on the left common carotid arteries.2. Micro-ultrasound measurementThe maximal and minimal intima-media thickness (IMT) and end-systolic diameters (Ds) were measured. Micro-ultrasound Imaging Measurement was performed to measure the maximal velocity (Vmax) of left and right carotid blood. Shear stress was calculated.3. Histological and morphology AnalysesSections were stained with hematoxylin and eosin (H&E). MT1-MMP was detected by immunostaining with anti-MT1-MMP antibody.4. Cell cultureEthical approval was obtained from Shandong University Research and the Ethics Committee for the procurement of human umbilical veins from healthy term pregnant women.HUVECs were freshly isolated from human umbilical cord veins with 0.1% Collagenase II (Sigma, St Louis, MO, USA), and grown in T25 flasks in M199 medium supplemented with 20% fetal calf serum, 100μg/ml streptomycin, 100 U/ml penicillin, and 20 ng/ml VEGF. Confluent primary cultures were harvested with use of 0.25% trypsin solution (Sigma, St Louis, MO), seeded onto slides pre-coated with 1% gelatin (Sigma). After 5 to 8 h, complete medium was added to flasks. The cells reached confluence in 3 to 4 days. HUVECs were grown in a humidified incubator in an atmosphere of 5% CO2/95% O2.5. Shear stress intervention3 to 9 passage cells were used and seeded onto slides and then cultured in sterile flasks. Culture media were added in after 8 h. These cells will be divided into various groups when they are confluent to 80%.5.1 The effect of low shear stress on MT1-MMP expression in different time point1) Static control;2) Exposure to low fluid shear stress for 1h;3) Exposure to low fluid shear stress for 3h;4) Exposure to low fluid shear stress for 5h;5.2 The effect of physiological shear stress and low shear stress on MT1-MMP expression1) Staic control;2) Low shear stress: exposure to low fluid shear stress for 1 h, 3h, 5h, respectively;3) Physiological shear stress: exposure to physiological fluid shear stress for 1 h, 3h, 5h, respectively;6. Real-time quantitative RT-PCR analysesTotal RNA from HUVECs was isolated using Trizol according to the manufacturer's instructions. The reverse transcription was performed at 42℃for 1 h using the MLV Kit. Real-time PCR was performed on a Light Cycler. Three technical replicates were run for each gene in each sample. The primers used for MT1-MMP amplification were 5'- ACGTGCAGCAGCATTGGA-3' and 5'-CAACAGGAGCAA GTGTGCCTTC-3'. The primers used forβ-actin were 5'-TGGACATCCGCAAAG AC-3' and 5'-GAAAGGGTGTAACGCAACTA-3\ Amplification was performed with 40 cycles and annealing at 62℃for 5 s, extension at 72℃for 10 s. The data was analyzed with Light Cycler software 4.0. MT1-MMP mRNA expression was normalized to the expressed housekeeping geneβ-actin.7. Western Blot AnalysisProtein was boiled for 5 min. Equal amounts of protein were separated by 14% SDS-PAGE and transferred to a nitrocellulose membrane. Following blocking with 5% non-fat milk, the blots were washed with PBS containing 0.1% Tween 20 and incubated with an appropriate primary antibody at 4℃overnight. The blots were probed with antibodies. After overnight incubation, the blots were washed with TBST and incubated with HRP-conjugated secondary antibody, then washed again. The blots were then visualized by use of enhanced chemiluminescence.8. MT1-MMP activity analysisAfter collected the cells, HUVECs were added an appropriate amount of cell protein extraction, 4℃incubated 15min; 4℃centrifuged 15000g 20min, then collect supernatant. Detect MT1-MMP activity in accordance with instructions.9. Statistical analysisData were presented as mean±SEM. For each condition, data from at least three independent experiments were quantified and analyzed by one-way ANOVA. And other data were analyzed using t procedure. A value of P<0.05 was considered statistically significant.Results1. Mice parametersIn total, one mouse died of anesthesia. There were 19 mice at the end of experiment.2. Micro-ultrasound MeasurementMicro-ultrasound imaging revealed that IMT of left carotid arteries was higher than that of right ones. And base on Ds and Vmax,τof left carotid arteries was lower than that of right ones.3. Plaque MorphologyLeft carotid arteries showed atherosclerotic lesions but not right carotid arteries. The actual shear stress levels significantly differed between the left and right carotidarteries (5.71±0.78 N/m2 vs. 9.70±1.70 N/m2, P<0.01).4. Endothelial cells IdentificationAccording to the results of immunofluorescence assay, the purity of endothelialcells in vitro is more than 95%.5. The effect of low fluid shear stress on MT1-MMP expression in different time point To explore the effect of mechanical stress on the expression of MT1-MMP, HUVECs were exposed to 4dyne/cm2 shear stress at various time points. The level of MT1-MMP mRNA significantly changed following 1 h of exposure, and MT1-MMP mRNA increased more sharply following 3 or 5 h of exposure. When HUVECs were subjected to low shear stress for 3 h or 5 h, there was a significant time-dependent increase in the MT1-MMP mRNA level. The level of active MT1-MMP protein had no obvious change after 1 h exposure to 4dyne/cm2 shear stress. After 3 h and 5 h exposure, the level was 1.5 and 2.3-fold higher than that in static control (P < 0.01).6. The effect of varied fluid shear stress on MT1-MMP expressionThe MT1-MMP mRNA level in HUVECs under varied fluid shear stress was measured by quantitative real time RT-PCR. Under low fluid shear stress (4 dyne/cm2), the mRNA level was comparable to that under static conditions after 1-h exposure but showed a significant time-dependent increase (P<0.05). However, the level decreased 3-fold after 5-h exposure to physiological shear stress (12 dyne/cm2) as compared with that under static conditions and approximately 10-fold as compared with that under low fluid shear stress.We measured the levels of active MT1-MMP in HUVECs, the protein level increased after 3 h exposure to low shear stress compared with that under static conditions (P<0.01). However, under 5-h physiological stress, the protein level decreased compared with that under static conditions (P<0.01).Conclusions1. In the model of low shear stress, MT1-MMP induced by low shear stress couldaccelerate atherosclerotic plaque formation.2. MT1-MMP was induced by low fluid shear stress in vitro, which indicates that MT1-MMP could play a key role in the progress of atherosclerotic plaque. Abstract IIMT1-MMP ACTIVATION ENHANCED BY LOW SHEAR STRESS THROUGH INTEGRIN PATHWAYBackgroundHemodynamics plays an important role in many various atheropathogenesis. Pober and Cotran summarized numerous researches about the relation of hemodynamics and atherosclerosis (AS) and raised shear stress hypothesis. They thought that the abnormal fluid shear stress was a significant factor to promote the formation of AS lesion.Hemodynamics has a visible impact on the morphous of endothelial cells (EC). The fluid in tubular aortas is laminar and ECs are elliptic that align in a direction to blood flow. There is complex turbulent flow in the bifurcation and curvature of vessel where the shape of ECs are polygonal lack of specific direction. Chronic changes of flow induce the remodel of aortas, alter the proliferation and death of cells, and change the balance of synthesis and degradation of extra cellular matrix. Shear stress hypothesis thinks that steady laminar fluid shear stress could selectively induce ECs atheroprotective gene expression, therefore, counteract harmful action of systemic dangerous factors to location.Membrane type-1 matrix metalloproteinase (MT1-MMP, MMP-14) is a protease and a major mediator of the proteolysis of pericellular and membrane-associated substrates, including collagens. MT1-MMP is highly expressed in atherosclerotic plaques and could activate other MMPs. It is involved in monocyte transmigration as well, an important mechanism of early atherosclerotic plaque formation. Recent works provides evidence that MT1-MMP could affect atherosclerosis development and plaque stability. So MT1-MMP plays a large role in vulnerable plaque.At present, it is not very clear about the relationship between shear stress and MT1-MMP expression in ECs. The regulation of signal transduction is known little. So, we raised this hypothesis that low and oscillatory shear stress induced MT1-MMP expression in HUVECs and physiological shear stress suppressed this expression.Objectives1. To identify whether low shear stress induces MT1-MMP expression in HUVECs through NF-κB in HUVECs.2. To identify which pathway low shear stress induces MT1-MMP expression in HUVECs through ERK1/2 or Akt.3. To identify which pathway low shear stress induces MT1-MMP expression in HUVECs through FAK.4. To identify which pathway low shear stress induces MT1-MMP expression in HUVECs through integrinβ1.Methods1. Cell CultureEthical approval was obtained from Shandong University Research and the Ethics Committee for the procurement of human umbilical veins from healthy term pregnant women.HUVECs were freshly isolated from human umbilical cord veins with 0.1% Collagenase II (Sigma, St Louis, MO, USA), and grown in T25 flasks in M199 medium supplemented with 20% fetal calf serum, 100μg/ml streptomycin, 100 U/ml penicillin, and 20 ng/ml VEGF. Confluent primary cultures were harvested with use of 0.25% trypsin solution (Sigma, St Louis, MO), seeded onto slides pre-coated with 1% gelatin (Sigma). After 5 to 8 h, complete medium was added to flasks. The cells reached confluence in 3 to 4 days. HUVECs were grown in a humidified incubator in an atmosphere of 5% CO2/95% O2. 2. Shear stress intervention3 to 9 passage cells were used and seeded onto slides and then cultured in sterile flasks. Culture media were added in after 8 h. These cells will be divided into various groups when they are confluent to 80%.2.1 NF-κB Regulates stress-induced MT1-MMP expression in HUVECs1) Static control: no shear stress, no any inhibitors;2) Exposing HUVECs to low shear stress for 1, 3, 5 h, repectively;3) Exposing HUVECs to physiological shear stress for 5 h following 2 h pretreatment with SN50.2.2 ERK1/2 or Akt leads to stress-induced MT1-MMP expression in a NF-κB-dependent manner in HUVECs1) Static control: no shear stress and no any inhibitors;2) Exposing HUVECs to low shear stress for 0, 5,10 min, 1, 5 h;3) Exposing HUVECs to low shear stress for 1, 5 h, respectively following 2 h pretreatment with PD98059;4) Exposing HUVECs to low shear stress for 1, 5 h, respectively following 2 h pretreatment with LY294002.2.3 FAK mediate stress-induced MT1-MMP expression via MAPK-NF-κB signaling pathways in HUVECs1) Static control: no shear stress and no any inhibitors;2) Exposing HUVECs to low shear stress for 0, 3, 5,10, min, 1, 5 h;3) Exposing HUVECs to low shear stress for 5min, 1, 5h, respectively following pretreatment with FAK siRNA;2.4 Integrinβ1 mediate stress-induced MT1-MMP expression via MAPK -NF-κB signaling pathways in HUVECs1) Static control: no shear stress and no any inhibitors;2) Exposing HUVECs to low shear stress for 0, 3, 5,10, min, 1, 5 h;3) Exposing HUVECs to low shear stress for 5min, 1, 5h, respectively following pretreatment with Integrinβ1 siRNA;3. Real-time Quantitative RT-PCR Analyses Total RNA from HUVECs was isolated using Trizol (mvitrogen) according to the manufacturer's instructions. The reverse transcription was performed at 42℃for 1 h using the MLV Kit (Promega). Real-time PCR was performed on a Light Cycler (Roche Applied Science, USA). Three technical replicates were run for each gene in each sample. The primers used for MT1-MMP amplification were 5'-ACGTGCAGCAGCATTGGA -3' (upper strand) and 5'- CAACAGGAGCAAGTG TGCCTTC -3' (lower strand). The primers used forβ-actin were 5'- TGGACATCC GCAAAGAC -3' (upper strand) and 5'- GAAAGGGTGTAACGCAACTA -3' (lower strand). Amplification was performed with 50 cycles and annealing at 56℃for 5 s, extension at 72℃for 10 s. The data was analyzed with Light Cycler software 4.0 (Roche Applied Science, USA). MT1-MMP mRNA expression was normalized to the expressed housekeeping geneβ-actin.4. Western Blot AnalysisProtein was boiled for 5 min. Equal amounts of protein were separated by 14% SDS-PAGE and transferred to a nitrocellulose membrane (BioRad, Hercules, CA). Following blocking with 5% non-fat milk, the blots were washed with PBS containing 0.1% Tween 20 and incubated with an appropriate primary antibody at 4℃overnight. The blots were probed with antibodies. After overnight incubation, the blots were washed with TBST and incubated with HRP-conjugated secondary antibody, then washed again. The blots were then visualized by use of enhanced chemiluminescence.5. Statistical analysisData were presented as mean±SEM. For each condition, data from at least three independent experiments were quantified and analyzed by one-way ANOVA. A value of P<0.05 was considered statistically significant.Results1. NF-κB Regulates stress-induced MT1-MMP expression in HUVECsHUVECs were exposed to 4 dyne/cm2 shear stress at various time points, and then total protein extracts were analyzed by Western blot. To define the role of NF-κB in the induction of MT1-MMP in stressed-HUVECs, transcription factor assay was performed. NF-κB DNA-binding activity was stronger after 1 h exposure to 4dyne/cm2 shear stress than that in static control (P<0.01). HUVECs were pretreated for 2 h with 18μM SN50, a cell-permeant peptide that interrupted translocation of NF-κB, and then subjected to 4dyne/cm2 shear stress for 1 h. The pretreatment with SN50 efficiently inhibited NF-κB DNA-binding activity (P<0.05). In the presence of the inhibitor, both MT1-MMP mRNA expression (P<0.01) and protein activity in the supernatant (P<0.01) were significantly attenuated. These results indicated that NF-κB played a crucial role in the expression of this cytokine in stressed-HUVECs.2. ERK1/2 leads to stress-induced MT1-MMP expression in a NF-κB -dependent manner in HUVECsHUVECs were exposed to 4dyne/cm2 stress at various time points. A rapid activation of ERK1/2, as determined by phosphorylation levels, occurred after low fluid shear stress exposure in HUVECs. Phosphorylations of ERK1/2 peaked at 5 min. Thereafter HUVECs were pretreated for 2 h with 20μM PD98059, a specific ERK1/2 inhibitor. Then HUVECs were exposed to 4dyne/cm2 shear stress. Stress-induced ERK1/2 was abolished by PD98059. MT1-MMP mRNA expression and protein activity were evidently inhibited by PD98059. HUVECs were incubated with PD98059 for 2 h before being stressed. The NF-κB DNA-binding activity was depressed obviously after 1 h.HUVECs were exposed to 4dyne/cm2 stress at various time points. Activation of Akt was not changed, as determined by phosphorylation levels. Thereafter HUVECs were pretreated for 2 h with 50μM LY294002, a specific Akt inhibitor. Then HUVECs were exposed to 4dyne/cm2 shear stress. MT1-MMP mRNA expression and protein activity were not changed inhibited by LY294002.3. FAK mediate stress-induced MT1-MMP expression via ERK1/2-NF-kB signaling pathways in HUVECsHUVECs were preincubated with FAK siRNA, and then given 4dyne/cm2 shear stress for 6 h. The shear stress-induced increases in MT1-MMP mRNA (p<0.01) and protein activity (P<0.01) were both significantly inhibited.HUVECs were pretreated with FAK siRNA before being projected to shear stress for 5 min or 15 min. Total protein was extracted and measured by western blot. Shear stress-induced ERK1/2 phosphorylations were inhibited after 5 min exposure.To examine NF-κB DNA-binding activity, HUVECs were pretreated with FAK siRNA before being exposed to 4dyne/cm2 shear stress for 1 h. Nuclear protein was extracted from the collected HUVECs and transcription factor assay was performed. NF-κB DNA-binding activity was depressed significantly (P<0.01)4. Integrinβ1 mediate stress-induced MT1-MMP expression via FAK-ERK1/2-NF-kB signaling pathways in HUVECsHUVECs were preincubated with Integrinβ1 siRNA, and then given 4dyne/cm2 shear stress for 6 h. The shear stress-induced increases in MT1-MMP mRNA (p<0.01) and protein activity (P<0.01) were both significantly inhibited.HUVECs were pretreated with Integrinβ1 siRNA before being projected to shear stress for 5 min or 15 min. Total protein was extracted and measured by western blot. Shear stress-induced ERK1/2 phosphorylations were inhibited after 5 min exposure.To examine NF-κB DNA-binding activity, HUVECs were pretreated with Integrinβ1 siRNA before being exposed to 4dyne/cm2 shear stress for 1 h. Nuclear protein was extracted from the collected HUVECs and transcription factor assay was performed. NF-κB DNA-binding activity was depressed significantly (P<0.01).Conclusions1. Integrins were involved in Low shear stress-induced regulate MT1-MMP expression in HUVECs.2. ERK1/2, FAK, and integrinβ1 was involved in Low shear stress-induced regulate MT1-MMP expression in HUVECs.3. NF-κB was involved in Low shear stress-induced regulate MT1-MMP expression in HUVECs. Abstract IIISIMVASTATIN INHIBITS MT1-MMP EXPRESSION ENDUCED BY LOW SHEAR STRESS IN HUVECsBackgroundRupture of vulnerable plaques is the most important etiological factor of myocardial infarction. Vulnerable plaques typically have a thin fibrous cap, large lipid-rich core, and abundant macrophages. Matrix metalloproteinases (MMPs) can degrade extracellular matrix, and their production and activation are strongly associated with degradation of subendothelial matrix, all important components of plaque rupture. Membrane type-1 matrix metalloproteinase (MT1-MMP, MMP-14) is a protease and a major mediator of the proteolysis of pericellular and membrane-associated substrates, including collagens. MT1-MMP is highly expressed in atherosclerotic plaques and could activate other MMPs. It is involved in monocyte transmigration as well, an important mechanism of early atherosclerotic plaque formation. Recent works provides evidence that MT1-MMP could affect atherosclerosis development and plaque stability. So MT1-MMP plays a large role in vulnerable plaque.Statins are commonly used to reduce plasma cholesterol levels, which significantly improves the morbidity and mortality associated with atherosclerosis. Recent research shows that simvastatin can inactivate integrinβ1 in cancer cells. However, whether simvastatin is involved in the shear stress pathway through integrins in endothelial cells is unknown. So, in this study, we aimed to explore the relation among and the mechanism of MT1-MMP, LSS, and simvastatin. Objectives1. To identify if simvastatin impact on MT1-MMP expression induced by low shear stress in HUVECs.2. To identify methods that effect of simvastin impact on stress-induced MT1-MMP expression in HUVECs.Methods1. Cell cultureEthical approval was obtained from Shandong University Research and the Ethics Committee for the procurement of human umbilical veins from healthy term pregnant women.HUVECs were freshly isolated from human umbilical cord veins with 0.1% Collagenase II (Sigma, St Louis, MO, USA), and grown in T25 flasks in M199 medium supplemented with 20% fetal calf serum, 100μg/ml streptomycin, 100 U/ml penicillin, and 20 ng/ml VEGF. Confluent primary cultures were harvested with use of 0.25% trypsin solution (Sigma, St Louis, MO), seeded onto slides pre-coated with 1% gelatin (Sigma). After 5 to 8 h, complete medium was added to flasks. The cells reached confluence in 3 to 4 days. HUVECs were grown in a humidified incubator in an atmosphere of 5% CO2/95% O2.2. Shear stress intervention3 to 9 passage cells were used and seeded onto slides and then cultured in sterile flasks. Culture media were added in after 8 h. These cells will be divided into various groups when they are confluent to 80%.2.1 The effect of simvastatin on MT1-MMP mRNA expression induced by low shear stress in different concentration1) Static control;2) Exposure to low fluid shear stress for 5 h;3) Exposing HUVECs to low shear stress for 5 h following 2 h, respectively pretreatment with with 1, 3, 5,10,20uM simvastatin.2.2 Effect simvastatin on MT1-MMP expression and activity1) Static control: no shear stress, no any inhibitors; 2) Exposing HUVECs to low shear stress for 5h;3) Exposing HUVECs to low shear stress for 5h following 2 h pretreatment with simvastain.2.3 Simvastin impact on MT1-MMP mRNA stability induced by low shear stress1) Static control: no shear stress and no any inhibitors;2) Exposing HUVECs to Actinomycin D for 0,1,2, 3, 5 h, pretreatment with low shear stress;3) Exposing HUVECs to simvastatin for 2h, then exposing Exposing HUVECs to Actinomycin D for 0,1,2,3, 5 h, pretreatment with low shear stress.2.4 Effect of Simvastatin on mediate signaling pathways of MT1-MMP expression induced by low shear stress in HUVECs1) Static control: no shear stress and no any inhibitors;2) Exposing HUVECs to low shear stress for 3, 5, 10min, 1h;3) Exposing HUVECs to low shear stress for 3, 5, 10min, 1h, respectively following 2 h pretreatment with simvastain.3. Real-time quantitative RT-PCR analysesTotal RNA from HUVECs was isolated using Trizol (Invitrogen) according to the manufacturer's instructions. The reverse transcription was performed at 42℃for 1 h using the MLV Kit (Promega). Real-time PCR was performed on a Light Cycler (Roche Applied Science, USA). The data was analyzed with Light Cycler software 4.0 (Roche Applied Science, USA).4. Western blot analysisProtein was boiled for 5 min. Equal amounts of protein were separated by 14% SDS-PAGE and transferred to a nitrocellulose membrane (BioRad, Hercules, CA). Following blocking with 5% non-fat milk, the blots were washed with PBS containing 0.1% Tween 20 and incubated with an appropriate primary antibody at 4℃overnight. The blots were probed with antibodies. After overnight incubation, the blots were washed with TBST and incubated with HRP-conjugated secondary antibody, then washed again. The blots were then visualized by use of enhanced chemiluminescence.5. mRNA decay assay. The decay rate of MT1-MMP mRNA was measured in an actinomycin D-stimulated time-course assay. Briefly, transcription was inhibited in HUVECs by culture in the presence of actinomycin D (20μg/ml, Sigma), and total RNA was extracted at selected times (0, 1, 2, 3, and 5 h). The relative abundance of MMP-14 mRNA was determined by quantitative RT-PCR.6. Statistical analysisData were presented as mean±SEM. For each condition, data from at least three independent experiments were quantified and analyzed by one-way ANOVA. A value of P<0.05 was considered statistically significant.Results1. Simvastin could inhibit MT1-MMP mRNA expressionTo explore the effect of simvastatin on the expression of MT1-MMP, HUVECs were exposed to simvastin for 2h, then HUVECs were wxposed to low shear stress. The level of MT1-MMP mRNA under simvastatin and low shear stress was significant decreased compared with only low shear stress.2. Simvastatin could inhibit MT1-MMP protein expression and depress its activitySimvastatin could inhibit MT1-MMP protein expression induced by low shear stress (P<0.01). And simvastatin could depress MT1-MMP activity (P<0.01).3. Simvastatin could reverse the LSS-induced increased stability of MT1-MMP mRNAUsing actinomycin D to block transcription, we compared HUVECs exposed to LSS or static conditions in terms of MT1-MMP mRNA decay. Before the addition of actinomycin D, HUVECs were pre-conditioned by their exposure to LSS (4 dyne/cm2 ) for 5 h or culture in the absence of flow. Compared with the rapid decay of MT1-MMP mRNA in cells cultured without flow, mRNA degradation was effectively halted by LSS. This effect was significant at each time point analyzed, which demonstrates the LSS-induced increase in stability of MMP-14 mRNA level.4. Simvastin could inhibit activation of signaling molecules involved in MT1-MMP expressionHUVECs were pretreated with 10μM simvastatin before being projected to shear stress for 5 min or 15 min. Total protein was extracted and measured by western blot. Shear stress-induced ERK1/2 phosphorylations were inhibited after 5 min exposure. To examine NF-κB DNA-binding activity, HUVECs were pretreated with 10μM simvastatin before being exposed to 4dyne/cm2 shear stress for 1 h. Nuclear protein was extracted from the collected HUVECs and transcription factor assay was performed. NF-κB DNA-binding activity was depressed significantly (P<0.01).Conclusions1. Simvastatin could inhibit MT1-MMP expression induced by low shear stress and MT1-MMP activity.2. Simvastatin could reverse the LSS-induced increased stability of MT1-MMP mRNA.3. Simvastatin could inhibit MT1-MMP expression via inhibition of the integrinβ1- FAK-ERK1/2-NF-κB pathway in HUVECs...
Keywords/Search Tags:Membrane type-1 matrix metalloproteinase, shear stress, endothelial cell, atherosclerosis, Integrinβ1, NF-kappa B, Shear Stress, siRNA, Endothelial Cells, Simvastatin, mRNA stability
Related items