The Study Of Innate Immunity Induced By Single-strand RNA Virus Via TLR7 And Viral Vaccine

Sensing and defeating microbial infections is essential to the survival of metazoan species. Innate immune responses form the first line of defense against infective disease.Innate immunity once was thought as a low grade form of the immune system replies for external stimulus.However,the importance of the nonspecific immune system is accepted by more and more persons gradually with understanding in depth to immune system.In the innate immunity,the evolution and mutation of pathogen will make the validity of discerned microbe weaken progressively.So as to host,the greatest challenge lies in discerning a large amount of different causative agent and replying rapidly through the limited receptor.The finding of Toll-like receptors(TLRs) and pathogen-associated molecular patterns (PAMPs) changed completely this view.As the most representative pattern-recognition receptor,TLRs can recognize PAMPs and induce the release of inflammatory factors that play an important role in innate immunity and can further activate the adaptive immune responses. So TLRs control the innate immunity and adaptive immune responses.Recently,more and more evidences have suggested that TLRs are involved in the recognition of viruses by the innate immunity,and that play an important part in antivirus. Virus is a relatively simple organism that consists of nucleic acid(DNA or RNA) and capsid protein.TLR4 is firstly found to recognize the F protein of respiratory syncytial virus(RSV) and activate monocytes.Especially recent finding,the nuclear acid composition of the virus, besides offering hereditary information,can be recognized by TLR3,TLR7,TLR8 and TLR9 which are expressed in corpuscular endosome,induce innate immunity and activate adaptive immune responses by releasing cytokines.TLR3 recognize viral double-stranded RNA, activate dendritic cells,B cells and macrophages to produce I-IFN.However TLR3-defective mouse lost this kind of function and apt to suffer infection of virus.TLR9 recognize nonmethylated CpG motif,recent findings have showed that herpes simple virus(HSV-2) infect bone marrow cell induce TLR9-dependent production of IFN-a.The similar result was found in HSV-1 too.Another conclusive evidence is that TLR9 mediated the anti- mouse cytomegalovirus(MCMV) immunity.However,the TLR-defective mouse produced higher virus titer and mortality increases greatly.TLR7 and TLR8 discern identical ligands,single-stranded RNA virus,because of the height homology on the sequence.The imazaquin was firstly identified as TLR7/8 ligand,and The synthetical has very strong antiviral activity.Subsequent research verified the single-stranded RNA as the natural ligand of TLR7/TLR8.Imazaquin may be have the structural similarity with ribonucleic acid.Recent findings have confirmed that the sequence of containing in G-U rich can stimulate TLR7/TLR8.TLR7 is necessary to recognize ssRNA virus by the research of gene-defective mouse,such as vesicular stomatitis virus and influenza virus,pDCs play a important role in detecting virus via TLR7.Ultraviolet-irradiated HSV,heat-inactivated and UV-inactivated HIV-1 can induce IFN-a responses comparable to their live counterparts in pDCs.pDCs recognition of these ssRNA viruses occurs independently of fusion or replication but requires attachment and endocytosis showing that infection by live virus is not required, and that the presence of viral genomic nucleic acids within the edosomal/lysosomal compartments is sufficient to activate antiviral pathways.However,other ssRNA virus,for example,RSV and VSV required live virus infection and viral replication intermediates were being detected in pDCs by autophage.Synthetic ssRNA oligonucleotides(ORN) mimic the virus RNA and induce the production of cytokines. RNA40(GCCCGUCUGUUGUGUGACUC) is the first single-stranded RNA motif screened from HIV and can be recognized by TLR7.However,the specific RNA motifs constitute of immunostimulatory ORN is unclear.For example,the length,sequence composition and chemical composition are not known for ORN to strongly activate immune response.ORN is a strong activator of TLR7 and induces production of Thl-type cytokines both in vitro and vivo.Cytokine production led to bystander activation of T and B cells.Furthermore,ORN can trigger the generation of antigen-specific cytotoxic T cells and of an IgG2a-biased antibody response to antigen in a sequence-dependent manner.And so,ORN can simultaneously activate the innate and adaptive immune response like the single-stranded RNA virus.Another research direction of the discerns lies that the kind of discernment makes the virus to adjust the genome of them in order to escape this kind of discernment in evolution.What we studied at first is the role of TLR7 in(HCV) continuously.More than 170 million people are infected with hepatitis C virus(HCV) and 55-85%of patients become chronically infected.HCV infection leads to chronic liver inflammation in the majority of patients.A substantial proportion of patients develop fibrosis or cirrhosis.Fibrosis is the result of defective repair of liver damage resulting from inflammation caused by effector cells of the immune system.Although it is clear that any agent that induces hepatocyte death sets up an inflammatory state in the liver that is associated with NF-kB activation,the precise molecular players responsible for this have only just begun to be elucidated.Some researches showed that the prevalence of TLR7 single nucleotide polymorphisms(SNP) in the patients chronically infected with HCV and their effect on liver fibrosis,and showed specific TLR7 SNPs have a significant effect on fibrosis progression in patients with chronic HCV infection. In the current study,we have confirmed that HCV encodes immunostimulatory RNA oligonucleotides(ORNs) that activate immune and inflammatory response via Toll-like receptor 7.Moreover,HCV-derived ORNs also activated inflammation-related transcription factor NF-kB in Huh-7 cells.The ORNs stimulation of human monocytes and murine macrophages resulted in the up-regulation of miR-155.The change also occurred in vivo when Balb/C mice were i.p.injected with the ORNs.Crucially,the increase was correlated with a reduction in the production of TNF-a.miRNAs are an evolutionarily conserved class of endogenous "22-nt noncoding RNAs involved in posttranscriptional gene repression and play important roles in shaping cellular development and differentiation.Consequently, dysregulated miRNA levels are associated with several types of malignancies including pancreatic cancer and breast cancer and so on.miR-155 is extremely important molecule in innate immunity,inflammation and cancer.Although the precise roles for miR-155 in supporting or terminating the development of an innate immune response and inflammation have yet to be demonstrated,its relation to the development of B cell malignancies is documented.Therefore,miR-155 may provide a potential link between the inflammatory response and cancer.Luciferase reporter assays demonstrated that miR-155 directly targets 3' untranslated region of MAP3K7IP2(TAB2) gene in TLR7 pathway.Functional studies demonstrated that transfection of miR-155 into RAW264.7 cells reduced the endogenous expression of the MAP3K7IP2 compared with no-transfected cells and decreased the production of TNF-a.These results suggest that HCV-encoded ORNs activated inflammatory response,which in turn was negatively regulated by miR-155,thus offering new target for prevention of hepatocellular carcinoma.Then,we investigated the interaction between the TLR7 and FMDV.Here we firstly cloned the porcine TLR7(pTLR7) cDNA encoding for 1050 amino acids.The pTLR7 exhibits 90%,87%,87%,86%,84%and 78%similarity to TLR7 from cattle,dog,horse,cat, human and mouse,respectively.RT-PCR data suggested that pTLR7 mRNA was mostly synthesized in secondary lymphoid tissue(spleen,lymph node and tonsil) and antigen-presenting cells(macrophage and B cell).The results of experiments in cells transfected with pTLR7 indicated that immunostimulatory RNA oligonucleotides(ORN) found in foot-and-mouth disease virus(FMDV) activated nuclear factor-kB and induced the expression of IFN-a via pTLR7.We showed that immunostimulatory ORN induced Thl-type cytokines and activated immunocytes in PBMC.The study provides foundation for further investigating pTLR7 interactions with its ligands and interactions between the porcine immune system and pathogens.The sequence-dependent adjuvant effect of ORN may play a role in enhancing the effect of mRNA-based vaccines.Furthermore,the addition of immunostimulatory RNA sequneces of mRNA vaccines could be used to enhance the potency of the vaccines.In addition,ORN show a therapeutic efficacy in vaccine formulations that is superior to TLR9 ligands because TLR7 are expressed in humans on a broad range of immune cells.Firstly,we investigated formation of virus-like particles by modified HBc fused with specified FMDV multiepitopes and evaluated their immune effects.Firstly,three HBc display vectors(pHBcl,pHBc2 and pHBc3) were constructed by deletions of different length within the HBc c/el region:75-78 amino acid,75-80 aa and 75-82 aa,respectively.Secondly,we inserted different compositions of FMDV multiepitopes,BT[VP 1(141-160)-VP4(21-40)]and BTB [VPI(141-160)-VP4(21-40)-VP1 (141-160)],into modified regions.As a result,only plasmid pHBc3-BTB of six recombinant vectors was expressed as soluble protein,which resulted in the formation of complete VLP confirmed by electron microscopy.Recombinant VLP could be uptaken by cells and presented in vitro and in vivo.Furthermore,the modified VLP displayed a significant stronger immunogenicity than other five recombinant proteins and GST-BTB with a higher titer of peptide-specific and virus-specific antibody,elevated IFN-γand IL-4 production,especially enhanced lymphocyte proliferation.The results encourage further work towards the development of FMDV vaccines using hepatitis B virus core particles fused with FMDV epitopes.VLP induced an acute activation of DC partly because the VLP is easy to be engulfed by DC.In addition,Proteomics was used for analysing the interaction of BMDCs with HBc-VLPs.Four conspicuous changed proteins from the comparison of HBc-pulsed-BMDCs and BMDCs were separated and identified by two-dimensional electrophoresis and mass spectrometry.Annexin A2(ANXA2) was found down-regulated expression and subsequently certified by western blotting;while the growth factor receptor bound protein 2(GRB2) was up-regulated.ANXA2,as the receptor of vitamin D3,could reduce the inhibition to DCs by down-regulation;while the up-regulated GRB2 might protect the DCs from apoptosis.So these proteins might play an important role in the cell vital process and enhance the activity of DCs.In conclusion,HBc-VLPs induced the strong potential of DCs antigen presentation,and the reason might due to the activity of DCs extended by HBc-VLPs.In summary,the study firstly identified the interaction between TLR7 and HCV.we have confirmed that HCV encodes immunostimulatory RNA oligonucleotides(ORNs) that activate immune and inflammatory response via Toll-like receptor 7.Moreover,HCV-derived ORNs also activated inflammation-related transcription factor NF-kB in Huh-7 cells.The ORNs stimulation of human monocytes and murine macrophages resulted in the up-regulation of miR-155.The change also occurred in vivo when Balb/C mice were i.p.injected with the ORNs.Crucially,the increase was correlated with a reduction in the production of TNF-a. Luciferase reporter assays demonstrated that miR-155 directly targets 3' untranslated region of MAP3K7IP2(TAB2) gene in TLR7 pathway.Functional studies demonstrated that transfection of miR-155 into RAW264.7 cells reduced the endogenous expression of the MAP3K7IP2 compared with no-transfected cells and decreased the production of TNF-a. These results suggest that HCV-encoded ORNs activated inflammatory response,which in turn was negatively regulated by miR-155,thus offering new target for prevention of hepatocellular carcinoma.Meanwhile,other ssRNA virus have the same property.FMDV can be recognized by porcine TLR7 and activate immune responses.In research of antiviral vaccine,the VLP recombinant vaccine containing multi-epitopes demonstrates good antiviral function.