Font Size: a A A

1.Transcriptional Regulation Of Disrupted In Schizophrenia 1 (DISC-1) Inhibits NFKB Mediated Inflammation

Posted on:2009-09-12Degree:DoctorType:Dissertation
Country:ChinaCandidate:Q LiuFull Text:PDF
GTID:1114360245488679Subject:Academy of Pediatrics
Abstract/Summary:
DISC1 is a novel interacting genetic factor intimately involved in cAMP metabolism with diverse cellular effects. Physiologically it has been demonstrated that DISC1 plays key role in modulating Phosphodiesterase (PDE) activity in neuronal cells and has been implicated in the molecular etiology of mood disorders in humans. Intracellular increases in cAMP trigger the release of DISC1-bound PDE's promoting its degradation to 5'AMP. Here we describe the transcriptional regulation of DISC1 by hypoxia and re-oxygenation (H/R), also known as hypoxia preconditioning (HPC), as key control point for cAMP metabolism and down stream inflammatory signaling. Initially, and based on the known anti-inflammatory effects of PDE inhibition we hypothesize that DISC1 endogenously control anti-inflammatory pathways. Using models of HPC we demonstrated a significant induction of DISC1 at RNA and protein levels as compared to cells exposed to hypoxia. We then tested the hypothesis that induction of DISC1 would result in decreased PDE activity with a subsequent increase in cellular cAMP concentrations. For this we measured intracellular cAMP levels in wild type cells (cultured pulmonary epithelia---Calu-3) after HPC or hypoxia only, found the level of cAMP was significantly higher in cells exposed to H/R when compared to normoxic and hypoxic cells. More over, after transfection of DISC1 plasmid into QBI293 cells, a similar increase of cAMP level was noticed. We then sought to understand the impact of DISC1 up-regulation and increased cAMP levels on inflammatory pathways. Based on the inhibitory effect of cAMP on the mitogen-activated protein kinase p38, which leads to NFkB suppression via inhibition of p38 phosphorylation, we studied the levels of P-p38 during HPC. Initially, using in vitro and in vivo models we demonstrated that HPC alone prevented phosphorylation of p38 and activation of NFkB. To further confirm this effect we transfected cells with DISC1 plasmid or siRNA, and showed that, similar to HPC, genetic up-regulation of DISC1 help to prevent phosphorylation of p38 during hypoxia, while knocked down, resulted in a increase of phosphorylation of p38 despite HPC. Additionally, we co-transfected cells with a NFkB-luciferase reported plasmid and with DISC1 plasmid or siRNA and demonstrated significant decrease in NFkB activation in hypoxic cells transfected with DISC1, however an increase in HPC cells transfected with siRNA. In summary, these results demonstrate that cyclic episodes of hypoxia and re-oxygenation result in the transcriptional over-expression of DISC1 a key regulatory molecule for cAMP metabolism, promoting an anti-inflammatory intracellular environment.Methods1. Murine preconditioning model.C57BL/6 (Charles River Laboratories) male mice of 8–10 weeks of age were used in this study. The Animal Care and Use Committee of Brigham and Women's Hospital approved all procedures. Whole-body preconditioning was performed in a manner similar to that previously described (4). Briefly, mice were placed in humidified environmental chambers and subjected to Fi O2 8% for 10 minutes followed by Fi O2 21% for 10 minutes for 3 cycles. The O2 concentrations in the chambers were continuously measured by an O2 analyzer. Following preconditioning, mice were subjected to FiO2 21% for 120 minutes. Preconditioned and nonpreconditioned animals were subsequently placed in the chambers and subjected to FiO2 5% for 10 minutes. Animals were then removed from the chamber and sacrificed, and pulmonary tissue was collected. For each experiment, 3 animals were treated in triplicate.2. Cell culture, and in vitro preconditioning.HeLa cells (ATCC) were maintained in DMEM plus 10% FBS, Calu-3 cells (ATCC) in MEM plus 10%FBS, at 37°C in a humidified incubator with 5% CO2 in room air. Cellular preconditioning was performed on cells following a modified in vivo protocol optimized for cells (4). Hela or Calu-3 cells were placed in a hypoxia chamber (Coy Laboratory Products Inc.) in pre-equilibrated hypoxic media at 2% O2 for 45 minutes, then re-oxygenated in normoxic conditions (21% O2) for 20 minutes. When cells were returned to hypoxia, media was once again replaced with fresh hypoxic DMEM or MEM in order to minimize the effects of oxygen present. This protocol was followed for 3 cycles.3. Transfections and NF-κB reporter assays.Transfection of Hela cells was carried out using Fugene 6 transfection reagent (Roche Diagnostics, 11814443001) as directed by the manufacturer. Plasmids used in transfections were DISC-1 siRNA or control siRNA-A (Sata Cruz Biotechnology, #sc60539 and sc37007). After 72 hours, cells were treated in hypoxia chamber as described above, then total protein or RNA were extracted for western blot or real time PCR assay. To measure transcriptional activity of NF-κB, on the second day of the transfection, HeLa cells in 6-well plates were transfected for the second time with pNF-κB-Luc (pNRE; Clontech) at a concentration of 1.6μg per well along with 0.08μg of Renilla for 24 hours and then either left at normoxia or subjected to a protocol of preconditioning. Following treatments, cells were rinsed in PBS, lysed in passive lysis buffer (Promega) for 15 minutes, and spun down, and 20μl of lysates was assayed using the Dual-Glo Luciferase assay system (Promega) with the use of a luminometer (Turner BioSystems).4. Transcriptional analysis.cDNA was collected Using"Clonetech sprint powerscript"after extraction of total RNA. Real-time PCR (Taqman, Apllied Biosystems) was employed to examine DISC-1 or IL-6 expression levels in HeLa cells following the instructions from the manufacturer. DISC-1 sense primer is 5'- CAGCACCCTGAGGAAGAAAG -3' and the antisense primer is 5'- TAGCCGTCCAGAAATGGTTT -3'. Ready-to-use IL-6 primer was ordered from Applied Biosystems. Samples were controlled forβ-actin using the following primers: sense 5'-GGTGGCTTTTAATGGCAAG-3'; antisense 5'-ACTGGAACGGTGAAGGTGACAG-3').5. Western blot.Total protein was isolated from HeLa or Calu-3 cells using cell lysis buffer (Cell signaling Technology, #9803), or extracted from lungs of mice with RIPA buffer (Cell signaling Technology, #9806), both containing protease inhibitor cocktail (Roche Diagnostics, #04693124001) and PMSF 1mM. Protein concentrations were measured by DC protein assay (Bio-Rad). An equal amount of protein was boiled in SDS loading buffer (Bio-Rad), then resolved on 8% polyacrylamide denaturing gels and transferred to nitrocellulose (Bio-Rad). After transfer, the membranes were stained with ponceau S stain in order to verify equal loading. Antibodies used for Western blotting included rabbit anti-DISC-1 (R47 1:800; Kindly donated by Dr J. Kirsty Millar, Medidcal genetics section, Molecular Medicine Center, University of Edinburgh, Edinburgh EH42XU, United Kingdom), rabbit anti–PDE4B (1:1000; Abcam), rabbit anti-p38 and P-p38 (1:1000; Cell signaling Technology), rabbit anti-actin (1:2,000; Cell signaling Technology). Blots were washed, and species-matched peroxidase -conjugated secondary antibody was added. Labeled bands from washed blots were detected by enhanced chemiluminescence (Thermol Scientific).6. Immunofluorescence study.For p65 nuclear translocation studies, HeLa cells were plated on 4-well glass chamber slides (Nalgene Nunc International) and allowed to grow to approximately 50-70% confluence, transfected with DISC-1 siRNA or control siRNA-A as described above, then treated in hypoxia chamber following in vitro preconditioning protocol. Cells were fixed in 1% paraformaldehyde/PBS at 4°C for 10 minutes and permeabilized with prechilled 0.2% Triton X-100/PBS/2% BSA. Cells were incubated with rabbit anti-p65 (1:200; Rockland Immunochemicals) in 1% normal goat serum in PBS for 1 hour followed by anti-rabbit Oregon Green 488 (1:100, Molecular Probes; Invitrogen) in the same buffer for 30 minutes. Cell images were captured on a fluorescence microscope.7. ELISA assay. Hela or Calu-3 cells were plated in BD culture dishes (10 cm in diameter) and allowed to grow to approximately 70-80% confluence, treated in hypoxia chamber following the in vitro preconditioning protocol, then cyclic AMP concentration of cell lysates were measured immediately using cAMP assay kit (R&D Systems, Inc. #KGE002) following steps instructed by the manufacturer: cells were lysed by cell lysis buffer, applied to the 96-well plates coated with goat anti-mouse antibody in triplicate, incubated at room temperature with primary antibody and cAMP conjugate on a orbital shaker at a speed of 500rpm for 3 hours, washed 3 times with wash buffer, optical density were then measured sequentially at 450nm and 570nm using a spectrophotometer (Bio-Rad). All reagents and the coated plates were provided in the kit.Where indicated, cells were treated with (all chemicals from Sigma-Aldrich, unless otherwise noted) DRB in DMSO at concentration of 10μM; Forsklin in DMSO at 10μM. Treatment time is indicated in results.Results1. Transcriptional regulation of DISC-1 by Hypoxia and HPC Initially, in vitro, we isolated total RNA from Calu-3 cells subjected to hypoxia or hypoxia/re-oxygenation, then measured DISC-1 mRNA using one-step Real-time PCR (see Methods for protocol). A 6-fold increase of mRNA level in HPC group was found compared with hypoxia and normoxia, while no significant difference between the later two groups. Further, DISC-1 protein from Calu-3 cells was studied through western blot. Results revealed a similar increase of DISC-1 protein in HPC group with that of mRNA. Sequentially, 5,6-Dichlorobenzimidazole 1-β-D-ribofuranoside (DRB), one well-known inhibitor of RNA synthesis was used in our study, at a concentration of 10uM for 30 minutes prior to the hypoxia treatment, then total protein were extracted and measured in the same way by western blot. As expected, no significant difference was found among groups of nomoxia, hypoxia and HPC after DRB treatment. In another word, the rise of DISC-1 protein during HPC was obstructed by transcription blocker, indicating the change of DISC-1 is transcriptional. In addition, in vivo study of DISC-1 protein was conducted using a mouse model. B57 mice were subjected to hypoxia or hypoxia/re-oxygenation according to the protocol, then total protein of the mice lungs was obtained and examined by western blot. Consistent to the result from Calu-3 cells, a sharp increase of DISC-1 protein in HPC group was confirmed in mice lung tissue.From above studies, a significant induction of DISC1 at RNA and protein levels during HPC was demonstrated as compared to hypoxia and normoxia groups2. DISC-1 regulates NF-κB activity during hypoxia and HPC To define the functional attributes of NF-κB inhibition by DISC-1, we used an NF-κB luciferase reporter. HeLa cells were transfected with DISC-1 plasmid or siRNA along with pNRE-Luc vector followed by exposure to normoxia, hypoxia (2% O2, 24 hours) or HPC followed by hypoxia (see HPC protocol in Methods). These studies revealed that wild type cells subjected to HPC displayed a significant attenuation of NF-κB activation compared with those exposed to hypoxia alone. While DISC-1 was knocked down at gene level, there was no more inhibition of NF-κB activation in the HPC group, on the other hand, when up-regulated, DISC1 significantly decreased NF-κB activation induced by hypoxia treatment, thus help to protect cells from inflammatory.Likewise, a well-established reporter gene for NF-κB activation is IL-6. In the course of these experiments, we examined the inhibition of IL-6 induction by HPC and whether such inhibition was attenuated by DISC-1 siRNA or enhanced by DISC-1 up-regulation. As shown by the result, hypoxia was a strong stimulus for induction of IL-6 mRNA in HeLa cells (10.4±2.0–fold increase compared with normoxia control; P < 0.01). Parallel examination in HeLa cells subjected to HPC revealed a loss of hypoxia-induced IL-6 (0.32±0.04–fold change compared with normoxia control; P < 0.01), while knocked DISC-1 down, IL-6 mRNA came back to a high level though cells were treated with HPC, composite to this, over-expession of DISC-1 inhibited the increase of IL-6 mRNA induced by hypoxia, thus confirming our findings from the NF-κB luciferase reporter experiments. 3. Affection of DISC-1 on the intracellular cyclic AMP levelCalu-3 cells were treated in nomoxia, hypoxia or HPC, intracellular cyclic AMP level of cells was then measured through ELISA assay (see Metholds for protocol). An increase of cyclic AMP was found in cells subjected to HPC, compared with hypoxia and normoxia groups (2-fold increase compared with normoxia control; P < 0.05). This result is consistent to the change of DISC1 in HPC, based on the recent study by Kirsty Millar et al. DISC1 is involved in cAMP metabalism through binding to PDE, which promotes cAMP degradation. To test if DISC1 can affect cAMP, we transfected QBI293 cells with DISC1 plasmid or siRNA and control vector, then treated cells with 10μM forskolin, a AC stimulator which can improve cAMP level for 30 minitues, measured cAMP immidiatly by ELISA. Data showed in DISC1over-expressing cells, cAMP level is obviously higher than that in control group and siRNA group, indicating DISC1 can raise the intracellular level of cAMP (2-fold increase compared with siRNA group; P < 0.05)4. DISC-1 is invovled in regulation of p38 phosphoralytion Sequentially, to confirm if DISC-1 is related to p38 phosphoralytion, which is thought to be a down-stream activity to cyclic AMP while up-stream to NF-κB translocation, we still knocked down DISC-1 and meseaured both p38 and Phospho-p38 at the same time using western blot. In wild type Hela cells, Phospho-p38 dropped dramatically to a lower level in HPC group compared with normoxia and hypoxia, while in those transfected with DISC-1 siRNA, Phospho-p38 did not drop after HPC treatment. Further more, when over-expressed DISC1 in cells, phosphoralytion of p38 was inhibited in both normoxia and hypoxia, supporting the hypothesis that phosphoralytion of p38 is regulated by DISC-1 during HPC.5. DISC-1 is involved in the regulation of IКBαphosphoralytion To confirm if DISC-1 is related to phosphoralytion of IКBα, which is thought to be an controller of NF-κB translocation, we genetically up-regulated or knocked down DISC-1 and conduct hypoxia treatments as described above, then measured both IКBαand Phospho- IКBαat the same time using western blot. In wild type Hela cells, Phospho- IКBαdropped dramatically to a lower level in HPC group compared with normoxia and hypoxia, while in those transfected with DISC-1 siRNA, Phospho- IКBαdid not drop after HPC treatment. Further more, when over-expressed DISC1 in cells, phosphoralytion of IКBαwas inhibited in both normoxia and hypoxia, supporting the hypothesis that phosphoralytion of IКBαis regulated by DISC-1 during HPC.ConclusionsDISC1 is first known as a gene related to phychiartric disease. Recently, Kirsty Millar et al demonstrated it also involved in metabolism of cAMP by binding to PDE4B when cAMP level is lifted. In our study of hypoxia preconditioning, we found a significant rise of DISC1 protein compared to cells exposed to hypoxia only. HPC courses a series of modifications to cells, which enhance their anti-inflammatory ability, including:1.Transcriptional increase of DISC12. DISC-1 regulates NF-κB activity during hypoxia and HPC3. DISC-1 regulates intracellular cyclic AMP level through interaction with PDE4B4. DISC-1 inhibits p38 phosphoralytion5. DISC-1 inhibits IКBαphosphoralytionSimply concluded, a transcriptional increase of DISC1 plays an important roll in the activity of anti-inflammatory, through its regulation on PDE4B activity, thus regulating cAMP- PKA-CREB-p38MAPK pathway. Inhibition on IКBαphosphoralytion is also involved in DISC's regulation on inflammation, while further study is needed. Prolonged exposure to Ketamine results in accelerated neurodegeneration and long-term neurocognitive deficits in postnatal day 7 (P7) rat pups. The cell cycle is the biological process that mediates eukaryotic cells prolferation. Pathological entry into the cell cycle leads to tumorgenesis in most cell types. However, mature neurons are postmitotic and typically do not proliferate. Experimental models of neurodegeneration have implicated the pathological entry of those neurons into the cell cycle leading to neuronal cell death. Our goal of this study is to characterize the effect of ketamine on the cell cycle signaling pathway in the developing brain in vivi and in vitro models.Methods: With the approval of the Investigational Review Board and adherence to the Guide for the Care and Use of Laboratory Animals, Sprague-Dawley postnatal day 7 (P7) rat pups and E18 pregnant rats were untilized for the experiments. Each rat pup received 4 intervals over 6 hours. Primary neuronal cortical cultures (PNCC) were isolated from 18-day gestation Sprague-Dawley rat fetuses. The cells were plated and stabilized for one day. Varying concentrations of ketamine were added into the wells for 6,12,24 and 48 hours in order to derive a dose and duration effect. Immunohistochemistry was used to detect the level of apoptosis by staining with the antibody to cleaved caspase-3 in brain tissue embedded in paraffin sections and E18 PNCCs fixed by 4%PFA. Secondly, total protein was isolated from E18 PNCCs, or from frozen brain tissue and standard immunobloting techniques was utilized to measure the marker of apoptosis---cleaved caspase-3 and the expression.of cell cycle-related proteins: cyclin D1, cdk4, E2F1 and Bim.Results: Ketamine mediated a dose and time depend increase of apoptosis level of neurons, and similar increase in cell cycle protein expression both in vivo and in vitro.Conclusion: Ketamine induces neuronal apoptosis and activates cell cycle signaling proteins in a dose and duration-dependent manner in the neonatal rat brain. Pathologic cell cycle reentry may be another mechmism for anesthetic-induced neuroapoptosis in the developing brain. Activated Caspase-3 has been established as a measure of ketamine and Isoflurane -induced neuroapoptosis in neonatal rodents and rhesus monkeys. These paradigms were performed in isolation without concurrent noxious stimulation: a condition that does not reflect the interaction of anesthesia and surgical stimulation. Anand and colleagues examined the effect of low (sedative 5 mg/kg) dose ketamine on P-7 rat pups subjected to repetitive inflammatory pain which accentuates neuronal excitation and cell death in developmentally regulated cortical and subcortical areas. This low dose of ketamine does not produce the typical neuroapoptotic signal in rodent models of this phenomenon. Given this report, we hypothesized that concurrent noxious stimulation with the administration of ketamine or isoflurane that produces neuroapoptosis will attenuate the characteristic caspase-3 activation observed in this paradigm.Methods:1. Treatment Groups: With the approval of the Investigational Review Board and adherence to the Guide for the Care and Use of Laboratory Animals postnatal day 7 (P7) Sprague-Dawley rat pups (6 pups per group) were randomized, no treatment (control), ketamine 20 mg/kg every 90 minutes X 4 times (k20), and ketamine 20 mg/kg every 90 minutes X 4 times with complete Freud's adjuvant injected in both hind paws after the first ketamine dose (k20+CFA).2. Administration of CFA: Subcutaneous injection of complete Freud's adjuvant produces tissue inflammation that last several days. Injection into the hind paw is a defined model of peripheral noxious stimulation in pain studies. After the administration of the first dose of ketamine, pups in the k20+CFA group received 0.1 ml CFA (9:1 saline) injection into each hindpaw under the plantar surface. This resulted in the typical inflammatory response on both hindpaws (Figure 1).3. Analysis of brain tissue: At the end of the 6 hour treatment period the rat pups were euthanized with pentobarbital (100 mg/kg i.p.). ?Three rats per group were perfused transcardially with saline followed by 4% paraformaldehyde fixative. The brains were extracted and embedded in paraffin. 5 micron sections were stained for cleaved caspase-3 using standard immunohistochemical techniques (9661, Cell Signal, Danvers, MA)4. The brains were extracted and immediately flash frozen. Protein was extracted from this tissue and subjected to standard immunoblotting techniques to mark cleaved caspase-3 (9661, Cell Signal, Danvers, MA). Results:Complete Freund's adjuvant (CFA) caused inflammation in the the P7 hind paw.Both group of pups were anesthetized with ketamine, then received a subplantar in injection of 0.1 ml CFA or saline in both hindpaws. The hindpaws of the treated rat were swollen throughout the experimental period (6 hours).Concurrent peripheral noxious stimulation reduced cleaved caspase-3 in the dorsolateral thalamus in Immnohistochemistry.There is some caspase-3 activation in the control group and increased expression in the ketamine only group. The ketamine + CFA group had intermediate expression.Concurrent peripheral noxious stimulation reduced cleaved caspase-3 in brain tissue.As predicted there was a 4-fold increase in cleaved-caspase-3 expression. Concurrent noxious stimulation attenuated this response. ConclusionsWe demonstrate that concurrent noxious stimulation attenuates neuroapoptosis that is observed when ketamine and isoflurane are administered in isolation respectively.Given that the clinical use of ketamine and isoflurane in human is always for the alleviation of pain, these data demonstrates that the phenomenon of ketamine-induced neuroapoptosis may not be significant in the care of pediatric patients exposed to surgical or procedural pain.
Keywords/Search Tags:Disc-1, anti-inflammatory, Hypoxia preconditioning, NF-кB, Ketamine, developing brain, neuron, apoptosis, cell cycle, Complete Freund's adjuvant, Ketamine, Isoflurane, nonmuture neuron
Related items