Font Size: a A A

Research On Inhibiting Neointimal Hyperplasia By Decoy Oligodeoxynucleotide Egr-1mRNA After Balloon Injury Of Rat Common Carotid Artery

Posted on:2008-06-22Degree:DoctorType:Dissertation
Country:ChinaCandidate:J J LiuFull Text:PDF
GTID:1114360242473132Subject:Internal Medicine
Abstract/Summary:
PrefaceThe technique of percutaneous coronary intervention(PCI)is regarded as one of useful treatments for coronary atherosclerosis heart disease,however,restenosis following PCI,which occurs in 30-40%of patients undergoing this procedure,limites its longer-term benefits.No pharmacologic strategies have demonstated definite benefits to reduce the rate of restenosis.Although silorimus- eluting stents might supress restenosis,its benefits have not yet been completely established.Therefor the hunt for efficient inhibitors of restenosis reminds an ongoing challenge.With the development of Molecularbiology,the gene transfer of vascular wall may be the best way to prevent restenosis.Early growth response factor-1(Egr-1)is a zinc finger structural factor that is activated under the outside stimulation of arterial injury leading to the splitting,migration and proliferation of vascular smooth muscle cell(VSMC)and neointimal hyperplasia,oligodeoxynucleotide(ODN)are catalytic antisense DNA molecules.Decoy ODN,one of them,comprises a catalytic domain composed of 15 deoxynucleotides,flanked by two substrate recognition arms each composed of 7-8 bases that bind to target RNA through Watson-Crick base-pairing The DNAzyme cleave a specific phosphodiester linkage between an unpaired purine(A,G)and a paired pyrimidine(C,U),oligodeoxynucleotide has practical threapeutic implic-ations as a new category of gene-inhibitor in pathophysiological settings.The aim of this study was to generate a novel decoy oligodeoxynuc- leotide Egr-1mRNA(decoy ODN)and observe the effect of decoy ODN on endothelial function of injured artery,phenotype of vascular smooth muscle cell(VSMC)and neointimal hyperplasia after ballon injury and to primarily study its mechanism of inhibiting neointimal hyperplasia.Materials and methods1,Synthesis of decoy ODNdecoy ODN was synthesized by Shanghai Bioasia.the base sequence was:upstream 5' TCGCCCTCGCCCCCGCTAAGGG3'downstream 5' CCCTTAGCGGGGGCGAGGGCGA3'.Scrambled decoy sequence wasupstream 5' AGCCGCACCGGCCTGCCTCGTC3downstream 5' GACGAGGCAGGCCGGTGCGGCT3'.Decoy ODN was modified by thioxo at the 3'end and 5'end,and was labeled with fluorescein isothiocyanate(FITC)at the 5'end to observe the distribution of genes after transfection by fluorescence microscope.2,experimental groupingNinety-six Wistar rats were randomly divided into four groups(n=24).The sham group was only tied with a ligature at the carotid artery without the insertion of catheter with no injury of carotid endomembrane.The bablanch group(the simple injury group): A 200μl solution(at 4℃)containing transfection reagent FuGENE6 30μl and 170μl mM MgCl2 was injected locally into injured vascular subsection and incubated for 20 minutes after balloon injury.The bablanch therapy group(FuGENE6+ Scrambled gene -group):A 200μl solution(at 4℃)containing FITC-labeled Scrambled gene 500μg, transfection reagent FuGENE6 30μl and 170μl 1mM MgCl2 was injected locally into injured vascular subsection and incubated for 20 minutes.The therapy group (FuGENE6+decoy ODN group):A 200μl solution(at 4℃)containing FITC-labeled decy ODN 500μg,transfection reagent FuGENE6 30μl and 170μl 1mM MgCl2 was injected locally into injured vascular subsection and incubated for 20 minutes The sham-group,MgCL2 group and FuGENEr-group served as control groups.Each group was again divided into four subgroups according to 3d,7d,14d,and 21d. 3,Animal model Ninety-six Wistar male rats weighing350-400 g were anesthetized using 10% hydronaldehyde(30mg/kg).The rats were cut in the middle of the neck and the left common and extermal carotid were exposed which was stopped from the bleeding at near or distal end by the serrefine by inserting.A 2-french Fogarty balloon catheter (Baxter Healthcare Corporation)was introduced through an arteriotomy to the extermal carotid,advanced into the common carotid,inflated to generate resitance and withdraw three times in the same manner that has been described.After removal of the catheter,a 200μl solution(at 4℃)containing FITC-labeled decoy ODN 500μg,transfection reagent FuGENE6 30μl and 170μl 1mM MgCl2 was injected locally into injured vascular subsection and incubateD for 20 minutes in FuGENE6+ decoy ODN group. Then tie external carotid artery with a ligature and resume blood stream,then suture the cut at the neck.After operation,use locally penicillin to prevent infection,feed standard food and make them drink freely.Six rats were sacrificed in each group on the 3rd,7th,14th and 21st days after operation and the blood was sampled from the heart for use before killing.In situ perfusion and fixation were done as the experiment required and the blood vessel was rapidly removed and frozen with liquid nitrogen and stored at-70℃.4,Determination of the serum level of nitric oxide(NO)and nitric oxide synthase(NOS)and endothelium(ET)concentrationBefore the rats were killed,get 4 ml of blood from the heart and inject it into test tube with or without anticoagulant.After centrifugation,get serum and blood plasma for detecting.The Determination of serum NO and NOS was made by nitric reductase as operated on the manual of NO test reagent box.NOS serum was determined by chemical colorimetry as described in the manual on the NOS reagent box.Blood plasma ET was determined by radioimmunoassay(RIA)carried out in the instruction manual as described on analytical reagent box5,Pathological morphology observationRats of each group was killed at separate time point and the left carotid was removed and fixed for 24 hours with 10%of neutral formaldehyde,and was imbedded in paraffin.Cut 3 pieces of slices randomly out of each section of blood vessel and stained with hematoxylin and eosin to observe the changes of vascular intima by the light microscope,then to analyze by using computer image analysis software.The thickness of intima and media was determined.The image analysis was done by those who are skilled in operation but do not know the fact.At the same time,2 mm of affected blood vessel was taken and fixed in 2.5%glutaraldehyde after washing with salt water and the pathological changes in the ultra structure of the vascular smooth muscle cell was observe by using transmission electron microscope(TEM).6,ImmunohistochemistryImmunohistochemistrical detection of carotid paraffin section(4μm)for Egr-1, bFGF and IGF-1 used by S-P method,rabbit polyclonal antibidies(Santa Cruz Biotechnology)diluted 1:100,antigen- antibody complexes were detected in 3-5 min using diaminobenzidine(DAB),counterstained with hematoxylin,dehydrated,cleared and mounted,then visualized by light microscopy.The numeration of the bFGFmasculine cell is to select 6 out of each section of the high power field and note respectively the numbers of cells both of Bichat's Tunic and of bFGF masculine with percentage and mean value.7,Western blot analysisTwo blood samples were grouped into one group and cut into pieces and added 500μl of precooling cracking buffer solution with homogenate on the ice.Then 12,000 g were centrifuged for 12 min.at 4℃.The top clear layer was total protein,which was absorbed and measured by UV spectrophotometer for the concentration of the total protein,packaged and stored at -70℃.A polyacrylamide gelatin was prepared and the protain sample put into boiling water bath for 5 min making the protein denatured.20μl of each protein sample was separated by 7.5%SDA-PAGE and transfer onto PVDF membranes,then membranes were blocked with non-fat skim milk powder for 2 hours. Membranes were incubated for the night with diluted antibodies,Egr-1(1:300),bFGF (1:300)and IGF-1(1:300),then were incubated diluted secondary antibodies(1:1000)1 hour.Protein bands were visualized using DAB,and protein band intensity determined by gel imaging analysator.Reverse8,transcription-polymerase chain reaction(RT-PCR)Total vascular tissue RNA was removed by using RNA out one-step method.Take vascular tissue 1 mg,which two as a group,and add RNAout.1 ml,after that cut and break,blow and beat and mix well.Place it at room temperature for 2 hours and then extract total RNA using chloroform and avantin.Measure A260nm/280nmratios using UV spectrophotometer in the range of 1.8-2.1 showing no RNA degradation.Store the product at-70℃.Reverse transcription was conducted with total RNA 3μg in each group for the synthesis of cDNA.The reverse transcription reaction was carried out in accordance with the standard described in the reverse transcription kit(from TaKaRa).The reaction conditions are:30℃10 min,45℃30 min,99℃5 min and 5℃10 min.The primer of bFGF,Egr-1,IGF-1 in PCR and of GAPDH,β-actin were designed and synthesized by TaKaRa.bFGF upstream:5'-TCGTTTCAGTGCCACATACCA-3',downstream:5'-GGGAGAAGAGCGACCCACA-3';Egr-1 upstream:5'-CAGTCGTAGTGACCACCTTACCA-3',downstream:5'-AGGTTGCTGTCATGTCTGAAAGAC-3';IGF-1 upstream:5'-TTGTTTCCTGCACTTCCTCTACTT-3', Downstream 5'-CCCTTTGCGGGGCTGA-3';GAPDH upstream:5'-ACCACAGTCCATGCCATCAC-3'Downstream 5'-TCCACCACCCTGTTGCTGTA-3';β-actin upstream:5'-GTGGGCCGCTCAAGGCACCAA-3',downstream:5'-CTTTAGCACGCACTGTAGTTTCTC-3'.Amplification fragments are bFGF 231bp,Egr-1 449bp,IGF-1 283 bp,GAPDG 456bpandβ-actin 400 bp respectively.Reaction conditions are respectively:bFGF 94℃preheated for 5 min,then 93℃30s,56℃30s,72℃60 s in 35 cycles,eventually 72℃till 10 min;Egr-194℃preheated 5 min,then 93℃30s,57℃30s,72℃60 s in 35 cycles,at last 72℃till 10 min;IGF-1 94℃preheated 5 min,then 94℃30s,55℃30s, 72℃60 s in 32 cycles,eventually 72℃till 10 min;GAPDH 94℃preheated 2 min, then 94℃30s,56℃30s,72℃60 s in 35 cycles and at last 72℃till 10 min.Gel electrophoresis of 1.5%of agarose was made with 10μl of average sample application stained by ethidium bromide(Ebr).The results were analyzed by gel imaging analysator.The length of RT-PCR amplification fragment was in agreement with that as expected.Each sample of bFGF and Egr-1 amplification straps were used as relative value of bFGF,Egr-1 and IGF-1 contents together with that of grey level of inner reference GAPDH9,Statistical analysisAll the data were analyzed using SPSS11.5 software package.Date are expressed as the mean±standard deviation.Group comparison was done using analysis of One-Way ANOVA.A P-value of less than 0.05(p<0.05)was considered to be statistically significant.Result1,Transfection of FITC-labeled decoy ODN into the artery.The intimal denudeation and green fluorescent excited by 470-490 nm optical can be seen in the intimal and medial layers at 24 houes after delivery of FITC labeled decoy ODN by the fluorescence microscope. 2,Serum NO,NOS and plasma ET levels.Compared with two control groups,the serum level of NO and NOS in FuGENE6+decoy ODN-group were higher.(p<0.05); but the level of ET in FuGENE6+decoy ODN-group was lower than that in two control groups(p<0.05).3,The intimal thickness existed on the day 7 in the arteries of the simple injury group and FuGENE6-group,and it was more significant on the day 14 and 21.In arteries treated with decoy ODN,the intimal hyperplasia decreased.The result observed by transmission electron microscopes:the vascular smooth muscle cell of neointima in 2 control groups may be contractile type,but vascular smooth muscle cell of neointima in FuGENE6+ decoy ODN group may be synthetic type.4,Immunohistochemistry,There is no expression of Egr-1 and bFGF in vascular wall in sham-group,but little expression of IGF-1 in sham-group.After balloon injury,the positive expression of bFGF,IGF-1 protein was obvious on the day 3.The expression of bFGF reached its peak on the day 14 and begun decreasing on the day 14.The expression of IGF-1 reached its peak on the day 14,but the expression of Egr-1 was persistent.Compared with two groups,the expression of Egr-1,bFGF,IGF-1 protein reduced at every time point in FuGENE6+ decoy ODN -group(p<0.001).5,There is no expression of bFGF mRNA in the sham-group,the expression of bFGF mRNA reached its peak on the day 3 and begun decreasing on the day 14 after balloon injury.The expression of IGF-1 mRNA reached its peak on the day 14.But the expression of Egr-1 mRNA existed on the day 3 and was persistent Compared with two groups,the expression level of Egr-1,bFGF,IGF-1 mRNA in FuGENE6+ decoy ODN -group reduced at every time point(p<0.001).DiscussionPCI is a main method of resolving ischemia-reperfusion hearts,however,arterial walls are injuried unavoidly during multipulation of using by cather,once it occurs, various transcription control genes,such as Egr-1,will be activated that might contribute to the smooth cells hyperplasia and trine extracellular matrix,thick neointimal will become fanially.We hypothesizes that smooth cells hyperplasia might be attenuated and thus intimalthickness be decreased by inhibiting the expression of these relevant genes.Egr-1 is an immediate-early gene product,a zinc-finger transcription factor and DNA-bindind protein that interacts with a consensus GC-rich region.For a number of reasons,we choose Egr-1 as a ideal target for therapeutic intervention to prevent restenosis.First,Egr-1 is poorly expreseed in the uninjured attery wall but is rapidly upregulated by mechanical injury.Second,Egr-1 controls the expression of a large number of gene whose products are implicated in development of vascular lessions and associated complication-factors that modulate migration, proliferation,extracellular maxtrix production,intercellular adhesion,and thrombosis. Third,besides injury,Egr-1 is activated by multiple external stimuli that may contribute to the pathogenesis of atherosclerotic and postangioplasty trstenotic lesions.These diverse influences may affect vascular remodeling and hyperplasia in atherogenesis, restenosis,hypertension,and ischemia reperfusion.Finally,Egr-1 and a large number of Egr-1-dependent genes have recently been detected in human atherosclerotic lesions. decoy ODN is a kind of DNA molecular with enzymatic activity,decoy ODN is one of 10-23 DRz family,which specially cleavs targeting mRNA.Compared with ribozymes, decoy ODN have many advantages:stable property,simple instruction,good accessibility to substrate,more cleaving targets to be choosen,higer sequent-specificity.In the normal state,the vascular endothelial cell forms barrier between blood and artery cells in complete succession in a single layer against the injured factor in the blood directly on the middle layer smooth muscle cell.At the same time,endothelial cell releases many growth inhibition factors to keep the media vascular smooth muscle cell(VSMC)in a quiet state inhibiting the proliferation of the VSMC.When the endothelial cell is injured,the balance of the endothelial cell and the smooth muscle cell is destroyed and the injured endothelial cell as well as smooth muscle cell release a great number of active matter causing VSMC proliferation to form neointima.NO, NOS and ET are all important indicator in reflecting endodermis secretion,which plays a key role in the vasculomotor adjustment.Its concentration depends largely on the restenosis after PCI.NO is a kind of cytokine with many biologic activities,which can expand blood vessel and increase volume of blood flow and at physical state by inhibiting the expression of vascular endothelial cellular adhesion molecule,the aggregation of blood platelet,the formation of mural thrombosis,the activation of WBC adhesion,inflammatory reaction of vessel wall,SMC division growth to promote apoptosis of its occurrence and the formation and thickening of neointima.NOS is NO synthetic rate-limiting enzyme,which reacts L-2-amino-5-guanidinovaleric acid and dioxygen in the body in the role of NOS to remove L-carbo-ammine acid and release NO.ET is,so far,the strongest vasoactive peptide for blood vessel contraction,and at the same time it has an activity just like stronger growth factor to promote vascular endothelial cell growth by autocrine or paracrine secretion.Study found that vascular endothelial cell damage resulted in the destruction of large amount of NOS and the decrease of NO and also increase the release of ET.Experiment found that the level of ET in FuGENE6+ decoy ODN -group was lower than that in two control groups but it was still higher than normal group due to the release of ET after Bichat's Tunic injury and the neointima still secret ET to stimulate the growth of smooth muscle.Experiment also found that ED5 could increase the release of NO and NOS after the injury of blood vessel.The notion of the increase of NO and NOS agreed with that of the release of NO by NOS catalytic L-2-amino-5-guanidinovaleric acid synthesis.Furthermore,the FuGENE6+ decoy ODN -group and two control groups had more release of NOS than sham group after blood vessel injury.So a compensatory mechanism was considered to keep the tension of the injured blood vessel and to decrease the thrombosis.Hence,the effect of decoy ODN on the vascular endothelial cell might be considered as having decoy ODN indirectly play a role in improving the vascular endothelial cell by inhibiting the synthesis of Egr-1 protein.It has been comfirmed that SMC proliferation and migration plays an important role in the restenosis after vascular injury.Study result indicated that there was some thickening in intima and narrowing in lumens after vascular injury.TEM found that the smooth muscle cell in normal arterial blood vessel showed contraction and the caryon showed Fusiform shape and there are a lot of actin filament in the cytoplasm and small amount of mitochondria at both sides of the nucleus.SMC cell body became larger, caryon increased and there were much mitochondria and golgiosome in endochylema with actin filament decreased showing synthetic type.In FuGENE6+ decoy ODN -group,SMC cell body and caryon were small and actin filament was relatively more with less mitochondria and golgiosome close to contracted SMC.It is shown that Ed5 can influence the phenotype transform of VSMC,inhibit smooth muscle overgrowth and intima proliferation by inhibiting Egr-1 synthesis,thus making the intima to grow less after vascular injury.Basic fibroblast growth factor(bFGF)is a kind of acid nuclear protein b.ag. related to the cell multiplication.The expression of bFGF is the mechanism of cell multiplication and also a reliable indicator reflecting cell multiplication.The study showed that normal tunic intima and tunica media had no expression of bFGF,which increased after the injury of Bichat's Tunic and decreased after the treatment with decoy ODN.It was considered that Egr-1 might participate in the control of the expression of bFGF,which might be related to the synthesis and package of bFGF protein.It is proved that Insulin-likegrowthfacter-1(IGF-1)is a kind of cytokine largely existed in the body.IGF-I emerges as an important factor that participates in the endogenous neuroprotective response of brain tiss-Ue to trauma.IGF-1 promotes the endothelial cell regeneration and the vascular growth as well as smooth muscle cell hyperplasy and the formation of extracellular matrix and inhibit the decomposition.In the study of vascular balloon injury in rats,it is found that the high expression of IGF-1 mRNA lasts 2 weeks or longer.The formation of neointima can be inhibited by the IGF-1 antibody Chamberlain et.al discovered that the activity of IGF-1 in the proliferative intima enhanced after PCI.All these show that IGF-1 plays a vital role in the formation of restenosis.Study also finds high expression of IGF-1 reached its peak on the day 14 after vascular balloon injury in rats.The decrease of the expression of IGF-1 after the treatment with decoy ODN may be related to the control of many IGF-1 expressions by Egr-1 in relation to the formation of angiostegnosis,decoy ODN decreases the expression of Egr-1 with the decrease of the expression of IGF-1.Experimental results show decoy ODN gene transfer may improve artery endothelial function after artery injury and can influence the phenotype transform of VSMC,and inhibit neointimal hyperplasia after balloon angioplasty by specially suppressing the expression of corresponding genes.Yet endometrial hyperplasia may not be inhibited completely because other factor participates in the process of the endometrial hyperplasia after vascular injury.Much remains to be done in future work..Conclusion1,decoy ODN gene transfer may improve artery endothelial function after artery injury to prevent restenosis.2,decoy ODN gene transfer may influence the phenotype transform of VSMC,and inhibit neointimal hyperplasia after balloon angioplasty.3,decoy ODN gene transfer may inhibit neointimal hyperplasia after balloon angioplasty by specially suppressing the expression of corresponding genes.
Keywords/Search Tags:decoy ODN, Egr-1, bFGF, IGF-1, endothelium, neointimal hyperplasia, rat
Related items