Mapping And Screening Of Susceptibility Genes For Mice Lupus Nephritis

ObjectiveSLE is a complex autoimmune disease of unknown etiology which is primarily characterized by the production of autoantibodies directed against nuclear antigens such as double-stranded DNA and chromatin. These antinuclear autoantibodies (ANAs) cause end-organ damage by a variety of mechanisms, notably via immune-complexmediated inflammation, which can result in glomerulonephritis (Lupus nephritis, LN).A great deal of evidence supports a genetic basis for susceptibility to SLE. Stochastic processes and environmental influences clearly also play a significant role in disease development and exacerbation. These can include stress, bacterial and viral infections, sun exposure, exogenous hormones and certain drugs. LN rarely occurs as a result of a single gene mutation. However, No single gene has been found to be necessary or sufficient to cause the disease. As with any multifactorial disease, this complicates the identification of disease genes.There is a low degree of penetrance associated with individual susceptibility loci, and different combinations of genes may be associated with disease development in different families. In addition, the lack of any strong selection against the susceptibility loci makes them fairly common in the general population. This makes their detection by linkage analysis difficult in human populations, which have a high degree of genetic variability. A useful alternative strategy when dealing with genetically complex diseases like LN is the elucidation of disease mechanisms in suitable animal models. These studies often yield valuable insights that can then be applied to human studies.There are numerous synthetic murine models and spontaneous murine models of lupus, including the NZB, (NZB×NZW)F1, MRL/lpr, MRL/n, BXSB mice. Among these models, (NZB×NZW)F1 mice develop systemic autoimmunity with ANA production and immunecomplex-mediated GN, much like that seen in humans, which also have a strong female gender bias in disease susceptibility. The severe nephritis indicate that both genetic backgrounds from NZB and NZW were needed for the high penetrance of fatal lupus nephritis.In this paper, we investigate the influence of the NZB-derived susceptibility loci on the development of mouse lupus nephritis, and how the loci alters the penetrance of proteinuria in New Zealand mice. We also screen some susceptibility genes nearby the NZB-derived susceptibility loci based on positional candidate cloning approach, in which the selected genes were consided relevant to the immunological function.Materials and MethodsPart 1:Mice:NZB, New Zealand White (NZW), and (NZBXNZW)Fl mice, were maintained in the same room and fed an identical diet. Backcross mice were obtained by crossing female (NZB×NZW)F1 mice with male NZW mice. Because of female predominance of SLE, only 220 female mice were used in the present study. Measurement of proteinuria:The onset of renal disease was monitored by biweekly testing for proteinuria. Mice with proteinuria of 111 mg/100 ml or more in repeated tests were considered positive. For quantitative trait loci (QTL) analysis, severity of renal disease was scored from grade 0 to grade 6, according to the amount of urinary albumin:0,<37mg/dl; 1,≥37mg/dl; 2,≥74mg/dl; 3,≥111mg/dl;4,≥333mg/dl; 5,≥1000mg/dl; 6,≥3000mg/dl. Genotyping for microsatellite markers:DNA was extracted from the mouse tail tissues. Genotyping for microsatellite markers was done using PCR. Microsatellite primers were purchased from Research Genetics (Huntsville, AL). PCR were run in a 96-well plate with 7.5 u 1 total volume containing 20 ng of genomic DNA. A three temperature PCR protocol (94,55, and 72℃) was conducted for 45 cycles in a Geneamp 9600 Thermal Cycler. PCR products were diluted 2-fold with loading buffer consisting of xylene cyanol and bromophenol blue dyes in 50% glycerin and were run on 15% polyacrylamide gels. After electrophoresis, gels were stained with ethidium bromide. Statistics:Linkages of particular microsatellite loci with development of proteinuria was estimated using a computer package program of MAPMAKER/EXP and MAPMAKER/QTL to identify chromosomal locations of QTL. The likelihood ratio statistic LOD of≥3.3 was used as the threshold for statistically significant linkage.Part 2:RT-PCR for synthetic cDNA:Total RNA was isolated from mouse spleen, liver, kidney cells using ISOGENE. First-strand cDNA was synthetized using an oligo(dT) primer. Serial primers were used to amplify cDNA products from NZB and NZW, which were selected based on EST nearby the susceptibility loci to screen candidate genes. PCR reactions were done in a PE9600 thermal cycler with 100μl total volume, then both strand were directly sequenced using special primers. The variation of amino acids were determinated by the difference of nucleotide contrasting sequence from NZB and NZW.Part 3:220 female mice were used to measure proteinuria. The onset of renal disease was monitored by biweekly testing for proteinuria which is 111 mg/100 ml or more in repeated tests to be considered LN. DNA was extracted from the mouse tail tissues and genotyping for the mutation of Bai2 and Tinagl was done by PCR using primers:F:caggtttgcacacactttgc,R:cgcctcctcctcctcctc for Bai2 and F: atccacagccacagaagagg, R:agcctggtgcatctttgtct for Tinagl. PCR were run in a 96-well plate with 20μl total volume containing 40 ng of genomic DNA. A three temperature PCR protocol (94,60, and 72℃) was conducted for 45 cycles in a Geneamp 9600 Thermal Cycler. PCR products were diluted 2-fold with loading buffer consisting of xylene cyanol and bromophenol blue dyes in 50% glycerin and were run on 15% polyacrylamide gels for single-strand comformation polymorphism electrophoresis (SSCP). Statistics:Backcross mice were grouped according to the Bai2 or Tinagl typing. The association of a specific genotype with renal disease (positive or negative of proteinuria) was quantified by theχ2 analysis.In addition, associations were determined using a standard (2 X 2) contingency matrix after mice were divided into four groups based on the different combinations of alleles, which means Bai2B/W/TinaglB/W, Bai2B/W/TinaglW/W, Bai2W/W/TinaglB/W and Bai2W/W/TinaglW/W.ResultsPart1:To assess the effect of the NZB-derived alleles on lupus nephritis, a genome-wide scan was performed in (NZB×NZW)F1×NZW backcross mice for QTL linked with higher protein levels of uria.151 markers were tested, covering over 97% of the genome with minimal gaps. Two relatively broad regions on chromosomes 4 and 17 with strong linkage were noted. One is located in the vicinity of NZB-type D4Mit71 on chromosome 4 (LOD>5), and the other is in the vicinity of on chromosome 17 (LOD>7), which indicate a remarkable linkage. The backcross progeny was separated into four groups, according to combinations of D17Mit22 and D4Mit71 genotypes:D4BW/D17BW group,D4BW/D17WW group,D4 WW/D17BW group and D4 WW/D17 group. The onset and cumulative incidence of proteinuria were compared among these four groups. As predicted by the backcross data, each of the two proteinuria-linked loci showed a gene-dosage effect on the incidence of proteinuria in the backcross mice. Thus, mice with two NZB alleles and two NZW alleles showed the highest and lowest cumulative incidence, respectively, and intermediate levels were observed in mice heterozygous for one NZB allele. Mice homozygous for NZB alleles at both chromosome 4 and 17 loci had strikingly elevated proteinuria levels compared with mice homozygous for NZW alleles at these loci. Thus, it is conceivable that the susceptibility to lupus nephritis in this backcross mice is mainly determined by additive effects contributed from each locus. Part2:During the course of screening mutations nearby susceptibility loci, we selected 41 candidate genes concerned with immunological fuction(data no shown).Among these genes,45 cDNA amplificated products were sequenced using specific primers, in which 41 single nucleotide mutation were detected and 14 changed amino acid affected products of 6 genes.Part3:The primers used for PCR-SSCP were designed to amplify fragments encompassing previously detected two substitutions within Bai2 and Tinagl genes, according to the genomic DNA sequence analysis. Because the size of PCR fragment optimal for SSCP analysis is 200-300bp, only the short strand encompassing the mutational site was amplified. To examine the influence of each genotype on renal disease, animals were initially placed into two groups based on heterozygote (B/W) or homozygote (W/W) for Bai2 and Tinagl alleles. An association of NZB-derived alleles with proteinuria levels was observed in both Bai2 and Tinagl genes, p<0.005. When all combination opportunities of Bai2 and Tinagl alleles were considered, the backcross progeny can be separated into four groups:Bai2B/W/TinaglB/W, Bai2B/W/TinaglW/W, Bai2W/W/TinaglB/W and Bai2W/W/TinaglW/W. Interestingly, the numbers of mice in Bai2B/W/ TinaglW/W and Bai2W/W/TinaglB/wgroups was very fewer, which indicate the strong linked relationship between Bai2 and Tinagl genes. However, the cumulative incidence of proteinuria were significant higher among Bai2B/W/TinaglB/W groups compared with Bai2W/W/TinaglW/W, p<0.005. When the backcross mice were divided into two subsets, according to positive or negative of proteinuria, the genotype frequency of Bai2B/w and TinaglB/W was significant higher than that of homozygote W/W in proteinuria subset. Therefore, it was considered that there are correlation between NZB-derived candidate genes and renal disease.Conclusion1,Two novel susceptibility loci of lupus nephritis are located in the vicinity of NZB-type D4Mit71 on chromosome 4 and of D17Mit22 on chromosome 17. Each locus contribute to the manifestation of renal disease, which has additive effects in this backcross mice.2,Among 11 mutant-alleles, six NZB-derived genes (i.e. Itlna,Tinagl,Bai2 Traf6,Hist3h2bb,Obscn) have 14 amino acid variances compared with NZW, which were considered likely to be candidate genes of LN, because of locations near the susceptibility loci.3,The cumulative incidence of proteinuria were significant higher in mice carring NZB-derived Tinagl and Bai2, which suggest that both were probable susceptibility genes to lupus nephritis.