Font Size: a A A

Reactive Oxygen Species Biphasically Regulates Multidrug-resistance Gene Expression In Renal Cell Carcinoma Cells

Posted on:2008-04-05Degree:DoctorType:Dissertation
Country:ChinaCandidate:Y S YinFull Text:PDF
GTID:1104360215958013Subject:Biochemistry and Molecular Biology
Abstract/Summary:
Background: Renal cell carcinoma (RCC) is the most common malignancy of human adult kidney and accounts for 2 to 3% of all cancers.As RCC respond poorly to anthracyclines, Vinca alkaloids, and other anticancer agents as a result of the intrinsic multidrug resistance (MDR) phenotype, most of the RCC patients have a poor prognosis. Overexpression of P-glycoprotein (P-gp) encoded by the multidrug resistance 1 (mdr1) gene is thought to be the major cause of the contribution to the intrinsic multidrug resistance phenotype in RCC cells. The development of P-gp inhibitors for clinical application has been hampered by unacceptable toxicity at doses required to achieve adequate cellular concentration. It is necessary to develop an alternative strategy which is more efficient and less toxic. Reactive oxygen species (ROS), including the superoxide radical(O2·-), hydrogen peroxide(H2O2), hydroxyl radical(·OH) and singlet oxygen(1O2), are continuously generated from the mitochondrial respiratory chain and have powerful oxidative potential. In past study, ROS is only thought to be hazardous for living organisms and damage all major cellular constituents.There is growing evidence that (ROS) play an important role as regulatory mediators in signaling processes. Recently, it has been pointed out that the expression of P-gp could be redox-regulated, intrinsic expression of the MDR transporter P-gp may be regulated by reactive oxygen species (ROS).Because on closer examination, a broad spectrum of structurally and functionally unrelated mdr1-inducing agents such as EGF, TNF-a,doxorubicin, benzo[a]pyreneor UV irradiation are known to trigger the production of ROS (including the superoxide anion radical, the hydroxyl radical or H2O2) as a common signal transduction pathway, indicating that ROS may regulate Pgp expression. Wartenberg et al have demonstrated that P-gp expression in multicellular prostate tumor spheroids is regulated by endogenously generated ROS (intracellular ROS levels). On the other hand, it has been reported that high levels of ROS resulting in severe cellular oxidative stress increased the expression of the multidrug resistance-associated protein-l(MRP-l). Objective:Using culture system of the human RCC lines ACHN and 786-0 which were overexpression of P-gp cell lines as a MDR model, to examined the effect of exogenous ROS (H2O2) on cell proliferation and determined whether exogenous H2O2 might regulate the expression of mdr1 gene in RCC cell lines in order to further study the MDR mechanism associated with ROS and to develop a new strategy that reverse drug resistance. Methods:1, ACHN and 786-0 cells were treated without and with exogenous H2O2 at the various concentration, the cell proliferation activity was measured by WST-1 cell proliferation and cytotoxicity Assay. Same method was used to evaluate the 50% inhibition concentration (IC50) of adriamycin, vincristine on RCC cells and to investigate the effect of exogenous H2O2 on modulate the toxicity of anticancer agents in RCC cells. 2, The effects of H2O2 on mdr1 mRNA expression was quantified by real-time RT PCR, which. was carried out with the upstream primer 5' CCTGTACGCCAACACAGTGC 3', and downstream primer 5' ATACTCCTGCTTGCTGATCC 3'. The effects of H2O-2 on expression P-gp were detected Western blot.The function of P-gp was evaluated by Rhodamine 123 retention assay. Results:1, H2O2 enhanced cell growth at lower concentration (about 0.00001mM—0.1mM), while H2O2 showed cytotoxicity at higher concentrations(more than 0.1mM) in a concentration-dependent manner. Both effect of H2O2 on the cell proliferation activity were time-dependent manner, maximal enhancemented effects under 0.01,0.02,0.04mM H2O2 and maximal suppressive effects under 0.1,0.2,0.4mM H2O2 was observed after 72h in culture.Treatment of RCC cells with combinations of H2O2 and adriamycin or vincristine for 72h, lower concentrations of H2O2 (0.005,0.01,0.02 mM) dramaticly increased the toxicity of ADM and VCR compared with single chemotherapeutic drugs treatments, under 0.02 mM H2O2 for 72 h, the sensitivity of ACHN to ADM or VCR was enhanced by 3.49, 2.95 times, the 786-O to ADM or VCR by 5.43, 4.47 times, respectively (P<0.01 v control or drug alone). whereas high concentrations of H2O2(0.2mM) resulted in significant increases in ADM IC50 or VCR IC50 by 3.0, 2.04 times in ACHN cells, by 2.85, 3.57 times in 786-O cells, (P<0.01 v control or drug alone), respectively. Meanwhile, ACHN cells or 786-O cell treated with 0.1 mM,0.2mM H2O for 72h markedly enhanced basal MDR1 mRNA overexpression, amounted to an 1.29-fold,3.4-fold and 1.35-fold ,2.82-fold increase in comparison with control cells, respectively(P < 0.01). In contrast , treated with 0.01,0.02mM H2O-2 for 72h, the result showed a significant decrease by 1.18-fold,4.05-fold and1.22-fold,3.76-fold, respectively (P<0.01). There was an consistency between MDR1 mRNA gene and P-gp expression proteins. Treatment ACHN or 786-O with 0.02mM H2O for 72h was able to increase Rh123 accumulation by different degrees, whereas with 0.2mM could decrease Rh123 accumulation (P<0.01). Conclusions:1, ROS exert a biphasic effect on cell growth, lower concentration of H2O2 can enhance RCC cell proliferation; higher concentration of H2O-2 can inhibit cell growth. 2, For the first time, these date demonstrated that the effect of H2O2 on regulation mdr1 mRNA expression showed biphasic characteristics. Lower concentration H2O2-pretreated RCC cells indicating down-regulation of mdr1 level. whereas, higher concentration H2O2-pretreated exhibited up-regulation of mdr1 level. 3, Low concentration of H2O2 may be a novel potential agent to reverse MDR phenotype in RCC.
Keywords/Search Tags:multidrug resistance (MDR), reactive oxygen species(ROS), g-lycoprotein (P-gp), ACHN, 786-O
Related items